Review




Structured Review

Proteintech gst tag
USP20 directly interacts with GPX4. ( A ) Immunoblot analysis of target proteins in sorafenib-resistant 769-P and A549 cells following 24 h treatment with specific deubiquitinase inhibitors. ML-323: 10 μM, GSK2643943A: 10 μM, XL177A: 10 μM, Spautin-1: 10 μM, IU1: 10 μM, AZ1: 10 μM, MF-094: 10 μM, LDN-57444: 10 μM, TCID: 10 μM, PR-619: 10 μM, BAY11-7082: 10 μM, EOAI3402143: 2.5 μM, ML364: 10 μM, b-AP15: 0.5 μM. ( B ) HEK293T cells were transfected with <t>GST-GPX4</t> <t>and</t> <t>Flag-USP.</t> The cell lysate was applied with GST pull-down, then analyzed with immunoblot for indicated proteins. ( C ) 769-P and A549 cells were subjected to immunoprecipitate with anti-GPX4 antibodies, then analyzed with immunoblot for indicated proteins. ( D ) Overview of USP20 structures. ( E-F ) HEK293T cells transfected with the indicated USP20 structures and Flag-GPX4 were subjected to pull-down with GSH beads or immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( G ) 769-P and A549 cells were subjected to subcellular fractionation, then analyzed with immunoblot for indicated proteins. ( H ) Overview of GPX4 isoforms structures. ( I ) HEK293T cells transfected with the indicated GPX4 isoforms and GST-USP20 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( J ) HEK293T cells transfected with the GST-USP20 WT/C154S and Flag-GPX4 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins.
Gst Tag, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 463 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/GST+Tag+Antibody/pmc13010945-36-17-66
Average 96 stars, based on 463 article reviews
gst tag - by Bioz Stars, 2026-09
96/100 stars

Images

1) Product Images from "USP20 governs tyrosine kinase inhibitors resistance through ferroptosis evasion by targeting GPX4 in cancers"

Article Title: USP20 governs tyrosine kinase inhibitors resistance through ferroptosis evasion by targeting GPX4 in cancers

Journal: Redox Biology

doi: 10.1016/j.redox.2026.104086

USP20 directly interacts with GPX4. ( A ) Immunoblot analysis of target proteins in sorafenib-resistant 769-P and A549 cells following 24 h treatment with specific deubiquitinase inhibitors. ML-323: 10 μM, GSK2643943A: 10 μM, XL177A: 10 μM, Spautin-1: 10 μM, IU1: 10 μM, AZ1: 10 μM, MF-094: 10 μM, LDN-57444: 10 μM, TCID: 10 μM, PR-619: 10 μM, BAY11-7082: 10 μM, EOAI3402143: 2.5 μM, ML364: 10 μM, b-AP15: 0.5 μM. ( B ) HEK293T cells were transfected with GST-GPX4 and Flag-USP. The cell lysate was applied with GST pull-down, then analyzed with immunoblot for indicated proteins. ( C ) 769-P and A549 cells were subjected to immunoprecipitate with anti-GPX4 antibodies, then analyzed with immunoblot for indicated proteins. ( D ) Overview of USP20 structures. ( E-F ) HEK293T cells transfected with the indicated USP20 structures and Flag-GPX4 were subjected to pull-down with GSH beads or immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( G ) 769-P and A549 cells were subjected to subcellular fractionation, then analyzed with immunoblot for indicated proteins. ( H ) Overview of GPX4 isoforms structures. ( I ) HEK293T cells transfected with the indicated GPX4 isoforms and GST-USP20 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( J ) HEK293T cells transfected with the GST-USP20 WT/C154S and Flag-GPX4 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins.
Figure Legend Snippet: USP20 directly interacts with GPX4. ( A ) Immunoblot analysis of target proteins in sorafenib-resistant 769-P and A549 cells following 24 h treatment with specific deubiquitinase inhibitors. ML-323: 10 μM, GSK2643943A: 10 μM, XL177A: 10 μM, Spautin-1: 10 μM, IU1: 10 μM, AZ1: 10 μM, MF-094: 10 μM, LDN-57444: 10 μM, TCID: 10 μM, PR-619: 10 μM, BAY11-7082: 10 μM, EOAI3402143: 2.5 μM, ML364: 10 μM, b-AP15: 0.5 μM. ( B ) HEK293T cells were transfected with GST-GPX4 and Flag-USP. The cell lysate was applied with GST pull-down, then analyzed with immunoblot for indicated proteins. ( C ) 769-P and A549 cells were subjected to immunoprecipitate with anti-GPX4 antibodies, then analyzed with immunoblot for indicated proteins. ( D ) Overview of USP20 structures. ( E-F ) HEK293T cells transfected with the indicated USP20 structures and Flag-GPX4 were subjected to pull-down with GSH beads or immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( G ) 769-P and A549 cells were subjected to subcellular fractionation, then analyzed with immunoblot for indicated proteins. ( H ) Overview of GPX4 isoforms structures. ( I ) HEK293T cells transfected with the indicated GPX4 isoforms and GST-USP20 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( J ) HEK293T cells transfected with the GST-USP20 WT/C154S and Flag-GPX4 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins.

Techniques Used: Western Blot, Transfection, Fractionation

USP20 removes GPX4 K48-linked poly-ubiquitination. ( A ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, GST-USP20 and His-Ub. ( B ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, GST-USP20 WT/C154S and His-Ub. ( C ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, and His-Ub under the condition of the indicated concentration of GSK2643943A. ( D ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in USP20 knockdown HEK293T cells transfected with Flag-GPX4 and His-Ub. ( E ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, HA-USP20 and His-Ub WT or His-Ub K48−only . ( F ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, HA-USP20 and His-Ub WT or His-Ub K48R .
Figure Legend Snippet: USP20 removes GPX4 K48-linked poly-ubiquitination. ( A ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, GST-USP20 and His-Ub. ( B ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, GST-USP20 WT/C154S and His-Ub. ( C ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, and His-Ub under the condition of the indicated concentration of GSK2643943A. ( D ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in USP20 knockdown HEK293T cells transfected with Flag-GPX4 and His-Ub. ( E ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, HA-USP20 and His-Ub WT or His-Ub K48−only . ( F ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, HA-USP20 and His-Ub WT or His-Ub K48R .

Techniques Used: Ubiquitin Proteomics, Transfection, Concentration Assay, Knockdown

Related Articles

Virus:

Article Title: SLC6A8-mediated creatine uptake suppresses ERK2-FSP1 signaling and induces ferroptosis in colorectal cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SLC6A8 HUABIO Cat# ER64976 p-ERK1/2 Proteintech Cat# 28733-1-AP; RRID: AB_2881202 ERK1/2 Proteintech Cat# 11257-1-AP; RRID: AB_2139822 p-Thr Santa Cruz Cat# sc-81527 p-Ser Santa Cruz Cat# sc-81514 ERK2 Abclonal Cat# A19630; RRID: AB_2862707 FSP1 Proteintech Cat# 20886-1-AP; RRID: AB_2878756 GPX4 ABclonal Cat# A11243; RRID: AB_2861533 HA Abclonal Cat# AE008; RRID: AB_2770404 Flag Proteintech Cat# 66008-4-Ig; RRID: AB_2918475 SLC7A11 Abclonal Cat# 26864-1-AP; RRID: AB_2880661 ACSL4 Proteintech Cat# 22401-1-AP; RRID: AB_2832995 DHODH Proteintech Cat# 14877-1-AP; RRID: AB_2091723 GAMT HUABIO Cat# HA500071; RRID: AB_3071170 β-actin Proteintech Cat# AC004; RRID: AB_2737399 p-MEK1/2 Abclonal Cat# AP1349 MEK1/2 Abclonal Cat# A4868; RRID: AB_2863368 Myc-tag Proteintech Cat# 16286-1-AP; RRID: AB_11182162 JNK Proteintech Cat# 66210-1-Ig; RRID: AB_2881601 p-JNK Proteintech Cat# 80024-1-RR; RRID: AB_2881601 GST Abclonal Cat# AE077 GFP Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 GAPDH Abclonal Cat# AC033 Goat Anti-Rabbit IgG (H + L) Jackson Cat# JAC-111-035-003 Goat Anti-Mouse IgG (H + L) Jackson Cat# JAC-115-035-003 Goat Anti-Mouse IgG Heavy Chain Abclonal Cat# AS064; RRID: AB_2864058 Goat Anti-Mouse IgG Light Chain Abclonal Cat# AS062; RRID: AB_2864056 FITC anti-mouse CD8a Biolegend Cat# 100705; RRID: AB_312744 APC anti-mouse CD4 Biolegend Cat# 100515; RRID: AB_312718 APC/Cyanine7 anti-mouse CD45 Biolegend Cat# 157618; RRID: AB_2890720 APC anti-mouse IFN-gamma eBioscience Cat# 17-7311-82; RRID: AB_469504 PE anti-mouse Granzyme B eBioscience Cat# 12-8898-82; RRID: AB_10870787 PE-CD279 (PD-1) eBioscience Cat# 12-9985-82; RRID: AB_466295 BD OptiBuild TM BV650 Mouse Anti- Mouse CD366 BD Pharmingen Cat# 747623; RRID: AB_2744189 InVivoMAb anti-mouse CD8a Bio X Cell Cat# BE0117; RRID: AB_10950145 InVivoMAb anti-mouse PD-1 Bio X Cell Cat# BE0273; RRID: AB_2687796 Bacterial and virus strains DH5a Beyotime Cat# D0351 Rosetta (DE3) Beyotime Cat# D0371 Chemicals, peptides, and recombinant proteins Cycloheximide MedChemExpress Cat# HY-12320 MG132 MedChemExpress Cat# HY-13259 Intracellular Fixation & Permeabilization Buffer Invitrogen Cat# 00-8333-56 (Continued on next page) 18 Cell Reports 44, 116139, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Biotin-BSA-Creatine Biotyscience N/A Necrostain 2 MedChemExpress Cat# HY-14622 Trametinib MedChemExpress Cat# HY-10999 Ferrostatin MedChemExpress Cat# HY-100579 CCK-8 TargetMol Cat# C0005 Creatine MedChemExpress Cat# HY-W010388 DPPH MedChemExpress Cat# HY-112053 Percoll Solarbio Cat# P8370 Phorbol 12-myristate 13-acetate MedChemExpress Cat# HY-18739 Ionomycin MedChemExpress Cat# HY-13434 Brefeldin A TargetMol Cat# T6062 Deferoxamine MedChemExpress Cat# HY-B1625R Liproxstatin-1 MedChemExpress Cat# HY-12726 NAC Yeasen Cat# 50303ES05 RSL3 Selleck Cat# S8155 Streptavidin Magnetic Beads Beyotime Cat# P2151 EGF Protein MedChemExpress Cat# HY-P7109 BODIPY TM 581/591 C11 Invitrogen TM Cat# D3861 dimethylsulfoxide (DMSO) Beyotime Cat# ST038 iFSP1 Selleckchem Cat# S9663 Brequinar Sodium (BRQ) Selleckchem Cat# S3565 Protease inhibitor cocktail MedChemExpress Cat# HY-K0010 GSH Beyotime Cat# S0073 DAPI (4 ′ ,6-Diamidino-2-phenylindole dihydrochloride) Sigma Cat# D9542 Z-VAD-FMK Adamas Cat# O8175 Critical commercial assays GSH and GSSG Assay Kit Beyotime Cat# S0053 Creatine Content Assay Kit Solarbio Cat# BC4925 BCA Protein Quantification Kit Epizyme Cat# ZJ102 Deposited data RNA-seq data This paper GSE285466 The mass spectrometry proteomics data This paper PXD061637 Experimental models: Cell lines HT-1080 Provided by Dr. Xiang Zhai in Wuhan University N/A DLD-1 ATCC Cat# CCL-221 SW480 ATCC Cat# CCL-228 MC38 Provided by Dr. Jin-Fang Zhang in Wuhan University N/A HEK293T ATCC Cat# CRL-1573 Experimental models: Organisms/strains BALB/c-Nude mice Hunan SJA Laboratory Animal Co., Ltd N/A C57BL/6 mice Hunan SJA Laboratory Animal Co., Ltd N/A Oligonucleotides shRNA sequences are listed in Table S4 This paper N/A Primers for constructs are listed in Table S5 This paper N/A (Continued on next page) Cell Reports 44, 116139, September 23, 2025 19

Article Title: Targeting UGCG sensitizes AML cells to venetoclax through RAB32-mediated endoplasmic reticulum-mitochondria communication.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies UGCG Santa cruz Cat# sc-293235; RRID:AB_10567522 GAPDH Monoclonal antibody proteintech Cat# 60004-1-Ig; RRID:AB_2107436 Beta Actin Recombinant antibody proteintech Cat# 81115-1-RR; RRID:AB_2923704 GRP78/BIP Monoclonal antibody proteintech Cat# 66574-1-Ig; RRID:AB_2881934 Phospho-PERK/EIF2AK3 (Ser719) Polyclonal antibody proteintech Cat# 29546-1-AP; RRID:AB_2935416 ATF4 Monoclonal antibody proteintech Cat# 60035-1-Ig; RRID:AB_2058598 Phospho-EIF2S1 (Ser51) Monoclonal antibody proteintech Cat# 68023-1-Ig; RRID:AB_2918767 RAB32 Polyclonal antibody proteintech Cat# 10999-1-AP; RRID:AB_2177047 CHOP; GADD153 Monoclonal antibody proteintech Cat# 66741-1-Ig; RRID:AB_2882089 XBP1 antibody abcam Cat# 37152; RRID:AB_778939 Goat Anti-Rabbit IgG antibody (HRP) proteintech Cat# SA00001-2; RRID:AB_2722564 Tubulin beta antibody Affinity Cat# AF7011; RRID:AB_3665037 p-IRE1a antibody Affinity Cat# AF7150; RRID:AB_2843590 Bcl-2 antibody Beyotime Cat# AF6285; RRID:AB_10718399 Cleaved caspase-3 Wanleibio Cat# WL01992; RRID:AB_3675878 ATF-6 Wanleibio Cat# WL02407; RRID:AB_3665487 LC3α/β Wanleibio Cat# WL01506; RRID:AB_2910622 TOM20 Polyclonal antibody proteintech Cat# 11802-1-AP; RRID:AB_2207530 PDI Polyclonal antibody proteintech Cat# 11245-1-AP; RRID:AB_2298937 Ceramide Enzo Cat# ALX-804-196; RRID:AB_10541503 DAPI Roche Cat# 10236276001 CoraLite488-conjugated Goat Anti-Mouse IgG(H + L) proteintech Cat# SA00013-1; RRID:AB_2810983 CoraLite594 – conjugated Goat Anti-Rabbit IgG(H + L) proteintech Cat# SA00013-4; RRID:AB_2810984 APC/Cyanine7 anti-human CD45 Antibody Biolegend Cat# 368516; RRID:AB_2566375 PE/Cyanine7 anti-human CD33 Antibody Biolegend Cat# 366618; RRID:AB_2566420 Bacterial and virus strains DH5α competent cell Vazyme Cat# C502-02 pLV[CRISPR]-hCas9:T2A:Puro-U6 for UGCG VectorBuilder N/A pLV[shRNA]-EGFP:T2A:Puro-U6 for PERK VectorBuilder N/A GV493 (hU6-MCS-CBh-gcGFP-IRES-puromycin) for ATF4/DRP1 GeneChem N/A GV112 (hU6-MCS-CMV-Puromycin) for RAB32 GeneChem N/A Biological samples Clinical samples from patients with acute myeloid leukemia The First Affiliated Hospital of Jinan University/Guangdong Provincial People’s Hospital N/A Chemicals, peptides, and recombinant proteins Trizol ThermoFisher Cat# 15596018 Eliglustat MedChemExpress Cat# HY-14885 Venetoclax MedChemExpress Cat# HY-15531 Lipofectamine 2000 Biosharp Cat# BL623B Polybrene Biosharp Cat# BL628A Recombinant human SCF Peprotech Cat# 300-07 Recombinant human FLT3L Peprotech Cat# 300-19 (Continued on next page) 18 Cell Reports 45, 117021, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant human IL-3 Peprotech Cat# 200-03 Recombinant human IL-6 Peprotech Cat# 200-06 Recombinant human TPO Peprotech Cat# 300-18 Critical commercial assays CCK-8 Yeasen Cat# 40203ES80 Apoptosis Assay kit Goonie Cat# 100-102 EdU Cell Proliferation Kit Beyotime Cat# C0071L CD34 MicroBead Kit Miltenyi Cat# 130-046-702 TSA 7-color kit Absinbio Cat# abs50015-100T Deposited data RNA-seq data for MV4-11 cells upon different treatments In this paper GSE315549 Experimental models: Cell lines MV4-11 American Type Culture Collection Cat# CRL-9591 THP-1 American Type Culture Collection Cat# TIB-202 HL-60 American Type Culture Collection Cat# CCL-240 MOLM13 CTCC Cat# CTCC-007-0236 HEK293T American Type Culture Collection Cat# CRL-3216 Experimental models: Organisms/strains Mouse: B-NDG BesTest Bio-Tech Co,.Ltd BST-DW Oligonucleotides sgUGCG#1 target sequence TGGCCAAAGCGATAGCTGAC VectorBuilder N/A sgUGCG#2 target sequence ACCATGTCAGTAAGCGTATC VectorBuilder N/A sgUGCG#3 target sequence TTACCGGTCAGCTATCGCTT VectorBuilder N/A shPERK#1 target sequence CTCAATCAAATGGACTTTAAA VectorBuilder N/A shPERK#2 target sequence ACGCTTGGAAGCAAGAATAAT VectorBuilder N/A shPERK#3 target sequence GCAGGACATCTGGTATGTTAT VectorBuilder N/A shATF4#1 target sequence CCACTCCAGATCATTCCTTTA GeneChem N/A shATF4#2 target sequence GTTGGTCAGTCCCTCCAACAA GeneChem N/A shATF4#3 target sequence GCCTAGGTCTCTTAGATGATT GeneChem N/A shRAB32#1 target sequence CCTTGAGAGCAGAGAACAAAT GeneChem N/A shRAB32#2 target sequence AGATTCTTGTAAACCACCAAA GeneChem N/A shRAB32#3 target sequence GTATACTACAAGGAAGCTGTT GeneChem N/A shDRP1#1 target sequence CGAGATTGTGAGGTTATTGAA GeneChem N/A shDRP1#2 target sequence CGGTGGTGCTAGAATTTGTTA GeneChem N/A shDRP1#3 target sequence GCTACTTTACTCCAACTTATT GeneChem N/A (Continued on next page) Cell Reports 45, 117021, March 24, 2026 19

Article Title: Herpes simplex virus type 1 disseminates from the cornea to the CNS in mice by thwarting type III interferon immune defenses.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-HSV-1 gD Santa Cruz Biotechnology Cat# sc-21719; RRID: AB_627720 Anti-cGAS Cell Signaling Technology Cat# #79978; RRID: AB_2905508 Anti-phospho-STING Cell Signaling Technology Cat# 72971; RRID: AB_2799831 Anti-STING Cell Signaling Technology Cat# 13647; RRID: AB_2732796 Anti-phospho-TBK1 Cell Signaling Technology Cat# 5483; RRID: AB_10693472 Anti-TBK1 Cell Signaling Technology Cat# 3504; RRID: AB_2255663 Anti-phospho-IRF-3 Cell Signaling Technology Cat# 29047; RRID: AB_2773013 Anti-IRF3 Proteintech Cat# 80519-1-RR; RRID: AB_2918899 Anti-phospho-STAT1 Cell Signaling Technology Cat# 9167; RRID: AB_561284 Anti-STAT1 Proteintech Cat# 66545-1-Ig; RRID: AB_2881907 Anti-SOCS1 Abcam Cat# ab280886; RRID: AB_2938872 Anti-SOCS3 Abcam Cat# ab280884; RRID: AB_3065200 Anti-β-Actin Abcam Cat# ab213262; RRID: AB_2924820 Anti-HA Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Anti-His Cell Signaling Technology Cat# 12688; RRID: AB_2744546 Anti-Myc Cell Signaling Technology Cat# 2278; RRID: AB_490778 Anti-IgG HRP Cell Signaling Technology Cat# 7076; RRID: AB_330924 Anti-IgG HRP Cell Signaling Technology Cat#7074; RRID: AB_2099233 Ant-CD326 Servicebio Cat# GB11274; RRID: AB_2941859 Anti-Neun Servicebio Cat# GB11138; RRID: AB_2868432 Anti-TUJ1 Servicebio Cat# GB15139 Anti-Ki67 Servicebio Cat# GB111499; RRID: AB_2927572 Anti-IgG HRP Servicebio Cat# GB23301; RRID: AB_2904020 Anti-IgG HRP Servicebio Cat# GB23303; RRID: AB_2811189 Anti-IgG Alexa Flour 488 Servicebio Cat# GB25301; RRID: AB_2904018 Anti-SOCS3 CoraLite 594 Proteintech Cat# CL594-66797; RRID: AB_3084727 Anti-STING CoraLite 488 Proteintech Cat# CL488-19851; RRID: AB_2883086 Anti-His-Tag CoraLite 647 Proteintech Cat# CL647-66005; RRID: AB_2920271 Anti-Myc-Tag CoraLite 488 Proteintech Cat# CL488-66003; RRID: AB_2883088 Bacterial and virus strains HSV-1 (WT) A kind gift from Prof. Junjie Zhang (Wuhan University) F strain HSV-1 ΔICP0 A kind gift from Prof. Junjie Zhang (Wuhan University) F strain HSV-1 ICP0R A kind gift from Prof. Junjie Zhang (Wuhan University) F strain Biological samples Human corneas Sun Yat-sen University Eye Center N/A Chemicals, peptides, and recombinant proteins MG132 MedChemExpress Cat#HY-13259 diABZI MedChemExpress Cat#HY-112921A C176 MedChemExpress Cat#HY-112906 Mouse IFN-λ protein Peprotech Cat#250-33 RNAiso Plus Takara Cat#9109 (Continued on next page) Cell Reports 44, 116581, December 23, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER RIPA buffer Solarbio Cat#R0010 Protease inhibitor cocktails Servicebio Cat#G2006 Protease inhibitor cocktails Servicebio Cat#G2007 Protease inhibitor cocktails Servicebio Cat#G2008 EDTA buffer Solarbio Cat#G1206 Critical commercial assays Lipofectamine 3000 Kit Invitrogen Cat#L3000015 Mouse IFN-λ ELISA Kit MEIMIAN Cat#MM-44821M1 Mouse IFN-α ELISA Kit MEIMIAN Cat#MM-0366M1 Mouse IFN-β ELISA Kit MEIMIAN Cat#MM-0124M1 cDNA Synthesis Kit Thermo Fisher Cat#K1622 TransStart Tip Green qPCR SuperMix Transgen Cat#AQ141-01 Anti-Myc-Magnetic Beads Beyotime Cat#P2183S BCA Kit Beyotime Cat#P0012 SDS-PAGE Kit Beyotime Cat#P0012AC ECL Kit Solarbio Cat#PE0010 TMR Tunel Kit Solarbio Cat#G1502 His pulldown kit FITGENE Cat#FI8805 TSA kit Servicebio Cat#G1223 TSA kit Servicebio Cat#G1231 Experimental models: Cell lines Vero ATCC RRID: CVCL_0059 U2OS Procell Cat#CL-0236 primary mouse corneal epithelial cells (mCECs) This paper N/A human primary corneal epithelial cells (hCECs) This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6J Guangdong Medical Laboratory Animal Center N/A Mouse: Sting − /− Gempharmatech Co., Ltd Cat#T012747 Mouse: Ifnlr1 − /− Gempharmatech Co., Ltd Cat#T013985 Mouse: Irf3 − /− Gempharmatech Co., Ltd Cat#T013849 Oligonucleotides Primers for RT-qPCR, see Table S1 This paper N/A Recombinant DNA HA-Ub-WT Hanbio Biotechnology Co. Ltd N/A HA-K48-Ub Hanbio Biotechnology Co. Ltd N/A HA-K63-Ub Hanbio Biotechnology Co. Ltd N/A Myc-STING Hanbio Biotechnology Co. Ltd N/A His-SOCS3 Hanbio Biotechnology Co. Ltd N/A Myc-STING mutants Hanbio Biotechnology Co. Ltd N/A Flag- SOCS1 Hanbio Biotechnology Co. Ltd N/A His-SOCS3 truncations Hanbio Biotechnology Co. Ltd N/A Software and algorithms GraphPad Prism (v8.0) GraphPad Software graphpad.com ImageJ National Institutes of Health https://imagej.net/ij/ ZEN software (v2.0) ZEISS zeiss.com 18 Cell Reports 44, 116581, December 23, 2025

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Article Title: Veillonella intestinal colonization promotes C. difficile infection in Crohn's disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit ASBT polyclonal antibody Proteintech Cat# 25245-1-AP; RRID:AB_2879986 Rabbit MEK1/2 recombinant rabbit mAb Starter Cat# S0B0857; RRID:AB_3676144 Rabbit Phospho-MEK1 recombinant antibody Proteintech Cat# 81304-1-RR; RRID:AB_2923714 Rabbit Erk1/2 antibody Abmart Cat# T40071; RRID:AB_2936996 Rabbit Phospho-Erk1/2 polyclonal antibody Starter Cat# S0B0902; RRID:AB_3676145 Rabbit c-Fos recombinant rabbit mAb Starter Cat# S0B0987; RRID:AB_3676146 Rabbit Phospho-c-Fos antibody Abmart Cat# TA3053M; RRID:AB_3676148 Rabbit JUN polyclonal antibody Proteintech Cat# 24909-1-AP; RRID:AB_2860574 Rabbit Phospho-JUN recombinant antibody Proteintech Cat# 80086-1-RR; RRID:AB_3085353 Rabbit β-actin polyclonal antibody Yeasen BioTech Cat# 30102ES40; RRID:AB_2923152 Goat anti-rabbit IgG (H+L) Starter Cat# S0B4002; RRID:AB_3676147 Bacterial and virus strains Clostridioides difficile (CD55, tcdA + tcdB + cdt -) Yang et al. 70 PMID: 36898551 Veillonella parvula DSM2008 ATCC DSM2008 Bacteroides fragilis ATCC25285 ATCC ATCC25285 Escherichia coli ATCC25922 ATCC ATCC25922 Veillonella parvula (VPC) This study N/A Veillonella parvula (VP-1) This study N/A Veillonella parvula (VP-2) This study N/A Veillonella parvula (VP-3) This study N/A Veillonella parvula (VP-4) This study N/A Veillonella parvula (VP-5) This study N/A Veillonella parvula (VP-6) This study N/A Veillonella parvula (VP-7) This study N/A Veillonella parvula (VP-8) This study N/A Bacteroides fragilis (BF-1) This study N/A Bacteroides fragilis (BF-2) This study N/A Bacteroides fragilis (BF-3) This study N/A Bacteroides fragilis (BF-4) This study N/A Bacteroides fragilis (BF-5) This study N/A Escherichia coli (EC-4 GFP) This study N/A Escherichia coli (EC-1) This study N/A Escherichia coli (EC-2) This study N/A Escherichia coli (EC-3) This study N/A Escherichia coli (EC-4) This study N/A Escherichia coli (EC-5) This study N/A Escherichia coli (EC-6) This study N/A Escherichia coli (EC-7) This study N/A Escherichia coli (EC-8) This study N/A Escherichia coli MFDpir (pConj6k+gfp, DAP Auxotrophic, KanR) Ferriè res et al. 71 N/A (Continued on next page) Cell Host & Microbe 33, 1518–1534.e1–e10, September 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human fecal samples from Crohn’s disease and Crohn’s disease patients with CDI This study N/A Chemicals, peptides, and recombinant proteins Fluorescein 5-isothiocyanate (FITC) MedChemExpress CAS No. 3326-32-7 c-Fos/activator protein (AP)-1 inhibitor (T-5224) MedChemExpress CAS No. 530141-72-1 Cy5ADA Chinese Peptide N/A (customization) Brain Heart Infusion broth Oxoid CM1135B Yeast Extract Oxoid LP0021B L-Cysteine hydrochloride monohydrate Sigma-Aldrich CAS No. 7048-04-6 Bacto peptone Gibco 211677 Protease peptone Sigma-Aldrich CAS No. 91079-38-8 Tris base Sangon BioTech CAS No. 77-86-1 Ammonium sulfate (NH4SO4) Sangon BioTech CAS No. 7783-20-2 Taurocholic acid sodium hydrate Sigma-Aldrich CAS No. 345909-26-4 Veillonella selective agar (ATCC medium 188) ELITE-MEDIA M360-02 Bacteroides Bile Esculin Agar LANSO BioTech AS02689 DL-Lactate Sigma-Aldrich CAS No.72-17-3 Defibrinated Sheep Blood Sbjbio Biology AC-S02 Vancomycin Sigma-Aldrich CAS No. 1404-93-9 Oxacillin Sigma-Aldrich CAS No. 1173-88-2 Proteinase K solution Sangon BioTech B600169 Agar Sangon BioTech CAS 9002-18-0 Dextran sulfate sodium (DSS) Yeasen BioTech CAS No. 9011-18-1 2,4,6-Trinitrobenzenesulfonic acid (TNBS) Sigma-Aldrich CAS No. 2508-19-2 GlutaMax Gibco 35050061 Non-essential amino acids Gibco 11140050 2-Mercaptoethanol Gibco 21985023 Phorbol myristate acetate Sigma-Aldrich CAS No. 16561-29-8 Rat collagen type I Corning CAS No. 9007-34-5 Dulbecco’s Modified Eagle Medium Gibco 11965092 Roswell Park Memorial Institute (RPMI) 1640 Gibco 11875093 1% (v:v) penicillin/streptomycin Yeasen BioTech 60162ES76 Heat-inactivated fetal bovine serum Gibco A5670801 Proteinase inhibitor phenylmethylsulfonyl fluoride (PMSF) Yeasen BioTech CAS No. 329-98-6 InStabTM Protease Cocktail Yeasen BioTech 20124ES03 Phosphatase inhibitor complex Sangon BioTech C500017 BeyoZonase Super Nuclease Beyotime Biotechnology D7121 RIPA lysis buffer Yeasen BioTech 20101ES60 Hank’s balanced salt solution Biosharp BL561A HEPES Gibco 15630106 KNO 3 (1M) Fu Lin BioTech GB/T603-2002 10% Formalin buffered with PB Biosci BioTech N/A Cy5-taurocholic acid Qiyue BioTech N/A (customization) Ammonium acetate Sigma-Aldrich CAS No. 631-61-8 Methanol Sigma-Aldrich CAS No. 67-56-1 Isopropanol Sigma-Aldrich CAS No. 67-63-0 Acetonitrile Sigma-Aldrich CAS No. 75-05-8 (Continued on next page) e2 Cell Host & Microbe 33, 1518–1534.e1–e10, September 10, 2025

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

Article Title: Diet-metabolism-transcription axis modulates the sensitivity to CDK4/6 inhibitors through RB1 in prostate cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal anti-RB1 Proteintech Cat# 10048-2-Ig; RRID: AB_2177320 Rabbit polyclonal anti-Rb (phospho S795) Abcam Cat# ab47474 Rabbit polyclonal anti-p-Rb (phospho Ser249, Thr252) ThermoFisher scientific Cat# 44-548G Rabbit polyclonal anti-CDK4 Proteintech Cat# 11026-1-AP; RRID: AB_2078702 Rabbit polyclonal anti-CDK6 Proteintech Cat# 14052-1-AP; RRID: AB_10642144 Rabbit polyclonal anti-ETS1 Proteintech Cat# 12118-1-AP; RRID: AB_10664925 Rabbit polyclonal anti- Cleaved Caspase-3 Proteintech Cat# 25128-1-AP; RRID: AB_3073913 Rabbit polyclonal anti- Beta Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Rabbit polyclonal anti-PCYT2 Proteintech Cat# 14827-1-AP; RRID: AB_2159298 Rabbit polyclonal anti-HA tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Rabbit polyclonal anti-Flag tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Mouse monoclonal anti-GFP tag Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 Bacterial and virus strains E.coli HB101 DL-Stbl3 Tsingke Cat# DLC106 Biological samples Patient-derived xenografts (PDX) Prostate cancer tissue from the Second Xiangya Hospital N/A Chemicals, peptides, and recombinant proteins Dimethyl sulfoxide (DMSO) MedChemExpress Cat# 67-68-5 Palbociclib (PD-0332991) HCl Selleck Cat# S1116 Abemaciclib Selleck Cat# S5716 TK216 Selleck Cat# S9718 VL285 Selleck Cat# S0095 Phosphatidylcholines Selleck Cat# E7211 Free Fatty Acids (FFAs) 0.5 mM Sodium Oleate and 0.25 mM Sodium palmitate Kunchuang Biotechnology Cat# KT003-004 Lipofectamine 2000 reagent Thermo Fisher Cat# 11668019 Trizol Accurate Biotechnology Cat# AG21102 Critical commercial assays Cell Counting Kit-8 Beyotime Cat# C0037 EndoFree Plasmid Midi Kit CWBIO Cat# CW2105S ClonExpress II One Step Cloning Kit Vazyme Cat# C112-01 Evo M-MLV reverse transcription premix kit Accurate Cat# AG11728 SYBR Green Pro Taq HS premixed qPCR kit Accurate Cat# AG11701 Deposited data Raw and analyzed sequencing data This paper GEO: GSE266425; GSE266426; CNCB: OMIX010430;OMIX010431 Experimental models: Cell lines Human: 22Rv1 Yuchicell Biology Cat# SC0129 Human: C4-2 SUNNCELL Biotechnology Cat# SNL-160 Experimental models: Organisms/strains Mouse: BALB/c-nu/nu Hunan SJA Experimental Animal Company N/A Mouse: NOD-PrkdcscidIl2rgem1/Smoc (NSG) Shanghai model organisms Cat# NM-NSG-001 (Continued on next page) 16 Cell Reports 44, 116530, November 25, 2025 ..

Recombinant:

Article Title: SLC6A8-mediated creatine uptake suppresses ERK2-FSP1 signaling and induces ferroptosis in colorectal cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SLC6A8 HUABIO Cat# ER64976 p-ERK1/2 Proteintech Cat# 28733-1-AP; RRID: AB_2881202 ERK1/2 Proteintech Cat# 11257-1-AP; RRID: AB_2139822 p-Thr Santa Cruz Cat# sc-81527 p-Ser Santa Cruz Cat# sc-81514 ERK2 Abclonal Cat# A19630; RRID: AB_2862707 FSP1 Proteintech Cat# 20886-1-AP; RRID: AB_2878756 GPX4 ABclonal Cat# A11243; RRID: AB_2861533 HA Abclonal Cat# AE008; RRID: AB_2770404 Flag Proteintech Cat# 66008-4-Ig; RRID: AB_2918475 SLC7A11 Abclonal Cat# 26864-1-AP; RRID: AB_2880661 ACSL4 Proteintech Cat# 22401-1-AP; RRID: AB_2832995 DHODH Proteintech Cat# 14877-1-AP; RRID: AB_2091723 GAMT HUABIO Cat# HA500071; RRID: AB_3071170 β-actin Proteintech Cat# AC004; RRID: AB_2737399 p-MEK1/2 Abclonal Cat# AP1349 MEK1/2 Abclonal Cat# A4868; RRID: AB_2863368 Myc-tag Proteintech Cat# 16286-1-AP; RRID: AB_11182162 JNK Proteintech Cat# 66210-1-Ig; RRID: AB_2881601 p-JNK Proteintech Cat# 80024-1-RR; RRID: AB_2881601 GST Abclonal Cat# AE077 GFP Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 GAPDH Abclonal Cat# AC033 Goat Anti-Rabbit IgG (H + L) Jackson Cat# JAC-111-035-003 Goat Anti-Mouse IgG (H + L) Jackson Cat# JAC-115-035-003 Goat Anti-Mouse IgG Heavy Chain Abclonal Cat# AS064; RRID: AB_2864058 Goat Anti-Mouse IgG Light Chain Abclonal Cat# AS062; RRID: AB_2864056 FITC anti-mouse CD8a Biolegend Cat# 100705; RRID: AB_312744 APC anti-mouse CD4 Biolegend Cat# 100515; RRID: AB_312718 APC/Cyanine7 anti-mouse CD45 Biolegend Cat# 157618; RRID: AB_2890720 APC anti-mouse IFN-gamma eBioscience Cat# 17-7311-82; RRID: AB_469504 PE anti-mouse Granzyme B eBioscience Cat# 12-8898-82; RRID: AB_10870787 PE-CD279 (PD-1) eBioscience Cat# 12-9985-82; RRID: AB_466295 BD OptiBuild TM BV650 Mouse Anti- Mouse CD366 BD Pharmingen Cat# 747623; RRID: AB_2744189 InVivoMAb anti-mouse CD8a Bio X Cell Cat# BE0117; RRID: AB_10950145 InVivoMAb anti-mouse PD-1 Bio X Cell Cat# BE0273; RRID: AB_2687796 Bacterial and virus strains DH5a Beyotime Cat# D0351 Rosetta (DE3) Beyotime Cat# D0371 Chemicals, peptides, and recombinant proteins Cycloheximide MedChemExpress Cat# HY-12320 MG132 MedChemExpress Cat# HY-13259 Intracellular Fixation & Permeabilization Buffer Invitrogen Cat# 00-8333-56 (Continued on next page) 18 Cell Reports 44, 116139, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Biotin-BSA-Creatine Biotyscience N/A Necrostain 2 MedChemExpress Cat# HY-14622 Trametinib MedChemExpress Cat# HY-10999 Ferrostatin MedChemExpress Cat# HY-100579 CCK-8 TargetMol Cat# C0005 Creatine MedChemExpress Cat# HY-W010388 DPPH MedChemExpress Cat# HY-112053 Percoll Solarbio Cat# P8370 Phorbol 12-myristate 13-acetate MedChemExpress Cat# HY-18739 Ionomycin MedChemExpress Cat# HY-13434 Brefeldin A TargetMol Cat# T6062 Deferoxamine MedChemExpress Cat# HY-B1625R Liproxstatin-1 MedChemExpress Cat# HY-12726 NAC Yeasen Cat# 50303ES05 RSL3 Selleck Cat# S8155 Streptavidin Magnetic Beads Beyotime Cat# P2151 EGF Protein MedChemExpress Cat# HY-P7109 BODIPY TM 581/591 C11 Invitrogen TM Cat# D3861 dimethylsulfoxide (DMSO) Beyotime Cat# ST038 iFSP1 Selleckchem Cat# S9663 Brequinar Sodium (BRQ) Selleckchem Cat# S3565 Protease inhibitor cocktail MedChemExpress Cat# HY-K0010 GSH Beyotime Cat# S0073 DAPI (4 ′ ,6-Diamidino-2-phenylindole dihydrochloride) Sigma Cat# D9542 Z-VAD-FMK Adamas Cat# O8175 Critical commercial assays GSH and GSSG Assay Kit Beyotime Cat# S0053 Creatine Content Assay Kit Solarbio Cat# BC4925 BCA Protein Quantification Kit Epizyme Cat# ZJ102 Deposited data RNA-seq data This paper GSE285466 The mass spectrometry proteomics data This paper PXD061637 Experimental models: Cell lines HT-1080 Provided by Dr. Xiang Zhai in Wuhan University N/A DLD-1 ATCC Cat# CCL-221 SW480 ATCC Cat# CCL-228 MC38 Provided by Dr. Jin-Fang Zhang in Wuhan University N/A HEK293T ATCC Cat# CRL-1573 Experimental models: Organisms/strains BALB/c-Nude mice Hunan SJA Laboratory Animal Co., Ltd N/A C57BL/6 mice Hunan SJA Laboratory Animal Co., Ltd N/A Oligonucleotides shRNA sequences are listed in Table S4 This paper N/A Primers for constructs are listed in Table S5 This paper N/A (Continued on next page) Cell Reports 44, 116139, September 23, 2025 19

Article Title: Targeting UGCG sensitizes AML cells to venetoclax through RAB32-mediated endoplasmic reticulum-mitochondria communication.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies UGCG Santa cruz Cat# sc-293235; RRID:AB_10567522 GAPDH Monoclonal antibody proteintech Cat# 60004-1-Ig; RRID:AB_2107436 Beta Actin Recombinant antibody proteintech Cat# 81115-1-RR; RRID:AB_2923704 GRP78/BIP Monoclonal antibody proteintech Cat# 66574-1-Ig; RRID:AB_2881934 Phospho-PERK/EIF2AK3 (Ser719) Polyclonal antibody proteintech Cat# 29546-1-AP; RRID:AB_2935416 ATF4 Monoclonal antibody proteintech Cat# 60035-1-Ig; RRID:AB_2058598 Phospho-EIF2S1 (Ser51) Monoclonal antibody proteintech Cat# 68023-1-Ig; RRID:AB_2918767 RAB32 Polyclonal antibody proteintech Cat# 10999-1-AP; RRID:AB_2177047 CHOP; GADD153 Monoclonal antibody proteintech Cat# 66741-1-Ig; RRID:AB_2882089 XBP1 antibody abcam Cat# 37152; RRID:AB_778939 Goat Anti-Rabbit IgG antibody (HRP) proteintech Cat# SA00001-2; RRID:AB_2722564 Tubulin beta antibody Affinity Cat# AF7011; RRID:AB_3665037 p-IRE1a antibody Affinity Cat# AF7150; RRID:AB_2843590 Bcl-2 antibody Beyotime Cat# AF6285; RRID:AB_10718399 Cleaved caspase-3 Wanleibio Cat# WL01992; RRID:AB_3675878 ATF-6 Wanleibio Cat# WL02407; RRID:AB_3665487 LC3α/β Wanleibio Cat# WL01506; RRID:AB_2910622 TOM20 Polyclonal antibody proteintech Cat# 11802-1-AP; RRID:AB_2207530 PDI Polyclonal antibody proteintech Cat# 11245-1-AP; RRID:AB_2298937 Ceramide Enzo Cat# ALX-804-196; RRID:AB_10541503 DAPI Roche Cat# 10236276001 CoraLite488-conjugated Goat Anti-Mouse IgG(H + L) proteintech Cat# SA00013-1; RRID:AB_2810983 CoraLite594 – conjugated Goat Anti-Rabbit IgG(H + L) proteintech Cat# SA00013-4; RRID:AB_2810984 APC/Cyanine7 anti-human CD45 Antibody Biolegend Cat# 368516; RRID:AB_2566375 PE/Cyanine7 anti-human CD33 Antibody Biolegend Cat# 366618; RRID:AB_2566420 Bacterial and virus strains DH5α competent cell Vazyme Cat# C502-02 pLV[CRISPR]-hCas9:T2A:Puro-U6 for UGCG VectorBuilder N/A pLV[shRNA]-EGFP:T2A:Puro-U6 for PERK VectorBuilder N/A GV493 (hU6-MCS-CBh-gcGFP-IRES-puromycin) for ATF4/DRP1 GeneChem N/A GV112 (hU6-MCS-CMV-Puromycin) for RAB32 GeneChem N/A Biological samples Clinical samples from patients with acute myeloid leukemia The First Affiliated Hospital of Jinan University/Guangdong Provincial People’s Hospital N/A Chemicals, peptides, and recombinant proteins Trizol ThermoFisher Cat# 15596018 Eliglustat MedChemExpress Cat# HY-14885 Venetoclax MedChemExpress Cat# HY-15531 Lipofectamine 2000 Biosharp Cat# BL623B Polybrene Biosharp Cat# BL628A Recombinant human SCF Peprotech Cat# 300-07 Recombinant human FLT3L Peprotech Cat# 300-19 (Continued on next page) 18 Cell Reports 45, 117021, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant human IL-3 Peprotech Cat# 200-03 Recombinant human IL-6 Peprotech Cat# 200-06 Recombinant human TPO Peprotech Cat# 300-18 Critical commercial assays CCK-8 Yeasen Cat# 40203ES80 Apoptosis Assay kit Goonie Cat# 100-102 EdU Cell Proliferation Kit Beyotime Cat# C0071L CD34 MicroBead Kit Miltenyi Cat# 130-046-702 TSA 7-color kit Absinbio Cat# abs50015-100T Deposited data RNA-seq data for MV4-11 cells upon different treatments In this paper GSE315549 Experimental models: Cell lines MV4-11 American Type Culture Collection Cat# CRL-9591 THP-1 American Type Culture Collection Cat# TIB-202 HL-60 American Type Culture Collection Cat# CCL-240 MOLM13 CTCC Cat# CTCC-007-0236 HEK293T American Type Culture Collection Cat# CRL-3216 Experimental models: Organisms/strains Mouse: B-NDG BesTest Bio-Tech Co,.Ltd BST-DW Oligonucleotides sgUGCG#1 target sequence TGGCCAAAGCGATAGCTGAC VectorBuilder N/A sgUGCG#2 target sequence ACCATGTCAGTAAGCGTATC VectorBuilder N/A sgUGCG#3 target sequence TTACCGGTCAGCTATCGCTT VectorBuilder N/A shPERK#1 target sequence CTCAATCAAATGGACTTTAAA VectorBuilder N/A shPERK#2 target sequence ACGCTTGGAAGCAAGAATAAT VectorBuilder N/A shPERK#3 target sequence GCAGGACATCTGGTATGTTAT VectorBuilder N/A shATF4#1 target sequence CCACTCCAGATCATTCCTTTA GeneChem N/A shATF4#2 target sequence GTTGGTCAGTCCCTCCAACAA GeneChem N/A shATF4#3 target sequence GCCTAGGTCTCTTAGATGATT GeneChem N/A shRAB32#1 target sequence CCTTGAGAGCAGAGAACAAAT GeneChem N/A shRAB32#2 target sequence AGATTCTTGTAAACCACCAAA GeneChem N/A shRAB32#3 target sequence GTATACTACAAGGAAGCTGTT GeneChem N/A shDRP1#1 target sequence CGAGATTGTGAGGTTATTGAA GeneChem N/A shDRP1#2 target sequence CGGTGGTGCTAGAATTTGTTA GeneChem N/A shDRP1#3 target sequence GCTACTTTACTCCAACTTATT GeneChem N/A (Continued on next page) Cell Reports 45, 117021, March 24, 2026 19

Article Title: Herpes simplex virus type 1 disseminates from the cornea to the CNS in mice by thwarting type III interferon immune defenses.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-HSV-1 gD Santa Cruz Biotechnology Cat# sc-21719; RRID: AB_627720 Anti-cGAS Cell Signaling Technology Cat# #79978; RRID: AB_2905508 Anti-phospho-STING Cell Signaling Technology Cat# 72971; RRID: AB_2799831 Anti-STING Cell Signaling Technology Cat# 13647; RRID: AB_2732796 Anti-phospho-TBK1 Cell Signaling Technology Cat# 5483; RRID: AB_10693472 Anti-TBK1 Cell Signaling Technology Cat# 3504; RRID: AB_2255663 Anti-phospho-IRF-3 Cell Signaling Technology Cat# 29047; RRID: AB_2773013 Anti-IRF3 Proteintech Cat# 80519-1-RR; RRID: AB_2918899 Anti-phospho-STAT1 Cell Signaling Technology Cat# 9167; RRID: AB_561284 Anti-STAT1 Proteintech Cat# 66545-1-Ig; RRID: AB_2881907 Anti-SOCS1 Abcam Cat# ab280886; RRID: AB_2938872 Anti-SOCS3 Abcam Cat# ab280884; RRID: AB_3065200 Anti-β-Actin Abcam Cat# ab213262; RRID: AB_2924820 Anti-HA Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Anti-His Cell Signaling Technology Cat# 12688; RRID: AB_2744546 Anti-Myc Cell Signaling Technology Cat# 2278; RRID: AB_490778 Anti-IgG HRP Cell Signaling Technology Cat# 7076; RRID: AB_330924 Anti-IgG HRP Cell Signaling Technology Cat#7074; RRID: AB_2099233 Ant-CD326 Servicebio Cat# GB11274; RRID: AB_2941859 Anti-Neun Servicebio Cat# GB11138; RRID: AB_2868432 Anti-TUJ1 Servicebio Cat# GB15139 Anti-Ki67 Servicebio Cat# GB111499; RRID: AB_2927572 Anti-IgG HRP Servicebio Cat# GB23301; RRID: AB_2904020 Anti-IgG HRP Servicebio Cat# GB23303; RRID: AB_2811189 Anti-IgG Alexa Flour 488 Servicebio Cat# GB25301; RRID: AB_2904018 Anti-SOCS3 CoraLite 594 Proteintech Cat# CL594-66797; RRID: AB_3084727 Anti-STING CoraLite 488 Proteintech Cat# CL488-19851; RRID: AB_2883086 Anti-His-Tag CoraLite 647 Proteintech Cat# CL647-66005; RRID: AB_2920271 Anti-Myc-Tag CoraLite 488 Proteintech Cat# CL488-66003; RRID: AB_2883088 Bacterial and virus strains HSV-1 (WT) A kind gift from Prof. Junjie Zhang (Wuhan University) F strain HSV-1 ΔICP0 A kind gift from Prof. Junjie Zhang (Wuhan University) F strain HSV-1 ICP0R A kind gift from Prof. Junjie Zhang (Wuhan University) F strain Biological samples Human corneas Sun Yat-sen University Eye Center N/A Chemicals, peptides, and recombinant proteins MG132 MedChemExpress Cat#HY-13259 diABZI MedChemExpress Cat#HY-112921A C176 MedChemExpress Cat#HY-112906 Mouse IFN-λ protein Peprotech Cat#250-33 RNAiso Plus Takara Cat#9109 (Continued on next page) Cell Reports 44, 116581, December 23, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER RIPA buffer Solarbio Cat#R0010 Protease inhibitor cocktails Servicebio Cat#G2006 Protease inhibitor cocktails Servicebio Cat#G2007 Protease inhibitor cocktails Servicebio Cat#G2008 EDTA buffer Solarbio Cat#G1206 Critical commercial assays Lipofectamine 3000 Kit Invitrogen Cat#L3000015 Mouse IFN-λ ELISA Kit MEIMIAN Cat#MM-44821M1 Mouse IFN-α ELISA Kit MEIMIAN Cat#MM-0366M1 Mouse IFN-β ELISA Kit MEIMIAN Cat#MM-0124M1 cDNA Synthesis Kit Thermo Fisher Cat#K1622 TransStart Tip Green qPCR SuperMix Transgen Cat#AQ141-01 Anti-Myc-Magnetic Beads Beyotime Cat#P2183S BCA Kit Beyotime Cat#P0012 SDS-PAGE Kit Beyotime Cat#P0012AC ECL Kit Solarbio Cat#PE0010 TMR Tunel Kit Solarbio Cat#G1502 His pulldown kit FITGENE Cat#FI8805 TSA kit Servicebio Cat#G1223 TSA kit Servicebio Cat#G1231 Experimental models: Cell lines Vero ATCC RRID: CVCL_0059 U2OS Procell Cat#CL-0236 primary mouse corneal epithelial cells (mCECs) This paper N/A human primary corneal epithelial cells (hCECs) This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6J Guangdong Medical Laboratory Animal Center N/A Mouse: Sting − /− Gempharmatech Co., Ltd Cat#T012747 Mouse: Ifnlr1 − /− Gempharmatech Co., Ltd Cat#T013985 Mouse: Irf3 − /− Gempharmatech Co., Ltd Cat#T013849 Oligonucleotides Primers for RT-qPCR, see Table S1 This paper N/A Recombinant DNA HA-Ub-WT Hanbio Biotechnology Co. Ltd N/A HA-K48-Ub Hanbio Biotechnology Co. Ltd N/A HA-K63-Ub Hanbio Biotechnology Co. Ltd N/A Myc-STING Hanbio Biotechnology Co. Ltd N/A His-SOCS3 Hanbio Biotechnology Co. Ltd N/A Myc-STING mutants Hanbio Biotechnology Co. Ltd N/A Flag- SOCS1 Hanbio Biotechnology Co. Ltd N/A His-SOCS3 truncations Hanbio Biotechnology Co. Ltd N/A Software and algorithms GraphPad Prism (v8.0) GraphPad Software graphpad.com ImageJ National Institutes of Health https://imagej.net/ij/ ZEN software (v2.0) ZEISS zeiss.com 18 Cell Reports 44, 116581, December 23, 2025

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Article Title: Veillonella intestinal colonization promotes C. difficile infection in Crohn's disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit ASBT polyclonal antibody Proteintech Cat# 25245-1-AP; RRID:AB_2879986 Rabbit MEK1/2 recombinant rabbit mAb Starter Cat# S0B0857; RRID:AB_3676144 Rabbit Phospho-MEK1 recombinant antibody Proteintech Cat# 81304-1-RR; RRID:AB_2923714 Rabbit Erk1/2 antibody Abmart Cat# T40071; RRID:AB_2936996 Rabbit Phospho-Erk1/2 polyclonal antibody Starter Cat# S0B0902; RRID:AB_3676145 Rabbit c-Fos recombinant rabbit mAb Starter Cat# S0B0987; RRID:AB_3676146 Rabbit Phospho-c-Fos antibody Abmart Cat# TA3053M; RRID:AB_3676148 Rabbit JUN polyclonal antibody Proteintech Cat# 24909-1-AP; RRID:AB_2860574 Rabbit Phospho-JUN recombinant antibody Proteintech Cat# 80086-1-RR; RRID:AB_3085353 Rabbit β-actin polyclonal antibody Yeasen BioTech Cat# 30102ES40; RRID:AB_2923152 Goat anti-rabbit IgG (H+L) Starter Cat# S0B4002; RRID:AB_3676147 Bacterial and virus strains Clostridioides difficile (CD55, tcdA + tcdB + cdt -) Yang et al. 70 PMID: 36898551 Veillonella parvula DSM2008 ATCC DSM2008 Bacteroides fragilis ATCC25285 ATCC ATCC25285 Escherichia coli ATCC25922 ATCC ATCC25922 Veillonella parvula (VPC) This study N/A Veillonella parvula (VP-1) This study N/A Veillonella parvula (VP-2) This study N/A Veillonella parvula (VP-3) This study N/A Veillonella parvula (VP-4) This study N/A Veillonella parvula (VP-5) This study N/A Veillonella parvula (VP-6) This study N/A Veillonella parvula (VP-7) This study N/A Veillonella parvula (VP-8) This study N/A Bacteroides fragilis (BF-1) This study N/A Bacteroides fragilis (BF-2) This study N/A Bacteroides fragilis (BF-3) This study N/A Bacteroides fragilis (BF-4) This study N/A Bacteroides fragilis (BF-5) This study N/A Escherichia coli (EC-4 GFP) This study N/A Escherichia coli (EC-1) This study N/A Escherichia coli (EC-2) This study N/A Escherichia coli (EC-3) This study N/A Escherichia coli (EC-4) This study N/A Escherichia coli (EC-5) This study N/A Escherichia coli (EC-6) This study N/A Escherichia coli (EC-7) This study N/A Escherichia coli (EC-8) This study N/A Escherichia coli MFDpir (pConj6k+gfp, DAP Auxotrophic, KanR) Ferriè res et al. 71 N/A (Continued on next page) Cell Host & Microbe 33, 1518–1534.e1–e10, September 10, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human fecal samples from Crohn’s disease and Crohn’s disease patients with CDI This study N/A Chemicals, peptides, and recombinant proteins Fluorescein 5-isothiocyanate (FITC) MedChemExpress CAS No. 3326-32-7 c-Fos/activator protein (AP)-1 inhibitor (T-5224) MedChemExpress CAS No. 530141-72-1 Cy5ADA Chinese Peptide N/A (customization) Brain Heart Infusion broth Oxoid CM1135B Yeast Extract Oxoid LP0021B L-Cysteine hydrochloride monohydrate Sigma-Aldrich CAS No. 7048-04-6 Bacto peptone Gibco 211677 Protease peptone Sigma-Aldrich CAS No. 91079-38-8 Tris base Sangon BioTech CAS No. 77-86-1 Ammonium sulfate (NH4SO4) Sangon BioTech CAS No. 7783-20-2 Taurocholic acid sodium hydrate Sigma-Aldrich CAS No. 345909-26-4 Veillonella selective agar (ATCC medium 188) ELITE-MEDIA M360-02 Bacteroides Bile Esculin Agar LANSO BioTech AS02689 DL-Lactate Sigma-Aldrich CAS No.72-17-3 Defibrinated Sheep Blood Sbjbio Biology AC-S02 Vancomycin Sigma-Aldrich CAS No. 1404-93-9 Oxacillin Sigma-Aldrich CAS No. 1173-88-2 Proteinase K solution Sangon BioTech B600169 Agar Sangon BioTech CAS 9002-18-0 Dextran sulfate sodium (DSS) Yeasen BioTech CAS No. 9011-18-1 2,4,6-Trinitrobenzenesulfonic acid (TNBS) Sigma-Aldrich CAS No. 2508-19-2 GlutaMax Gibco 35050061 Non-essential amino acids Gibco 11140050 2-Mercaptoethanol Gibco 21985023 Phorbol myristate acetate Sigma-Aldrich CAS No. 16561-29-8 Rat collagen type I Corning CAS No. 9007-34-5 Dulbecco’s Modified Eagle Medium Gibco 11965092 Roswell Park Memorial Institute (RPMI) 1640 Gibco 11875093 1% (v:v) penicillin/streptomycin Yeasen BioTech 60162ES76 Heat-inactivated fetal bovine serum Gibco A5670801 Proteinase inhibitor phenylmethylsulfonyl fluoride (PMSF) Yeasen BioTech CAS No. 329-98-6 InStabTM Protease Cocktail Yeasen BioTech 20124ES03 Phosphatase inhibitor complex Sangon BioTech C500017 BeyoZonase Super Nuclease Beyotime Biotechnology D7121 RIPA lysis buffer Yeasen BioTech 20101ES60 Hank’s balanced salt solution Biosharp BL561A HEPES Gibco 15630106 KNO 3 (1M) Fu Lin BioTech GB/T603-2002 10% Formalin buffered with PB Biosci BioTech N/A Cy5-taurocholic acid Qiyue BioTech N/A (customization) Ammonium acetate Sigma-Aldrich CAS No. 631-61-8 Methanol Sigma-Aldrich CAS No. 67-56-1 Isopropanol Sigma-Aldrich CAS No. 67-63-0 Acetonitrile Sigma-Aldrich CAS No. 75-05-8 (Continued on next page) e2 Cell Host & Microbe 33, 1518–1534.e1–e10, September 10, 2025

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

Article Title: Diet-metabolism-transcription axis modulates the sensitivity to CDK4/6 inhibitors through RB1 in prostate cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal anti-RB1 Proteintech Cat# 10048-2-Ig; RRID: AB_2177320 Rabbit polyclonal anti-Rb (phospho S795) Abcam Cat# ab47474 Rabbit polyclonal anti-p-Rb (phospho Ser249, Thr252) ThermoFisher scientific Cat# 44-548G Rabbit polyclonal anti-CDK4 Proteintech Cat# 11026-1-AP; RRID: AB_2078702 Rabbit polyclonal anti-CDK6 Proteintech Cat# 14052-1-AP; RRID: AB_10642144 Rabbit polyclonal anti-ETS1 Proteintech Cat# 12118-1-AP; RRID: AB_10664925 Rabbit polyclonal anti- Cleaved Caspase-3 Proteintech Cat# 25128-1-AP; RRID: AB_3073913 Rabbit polyclonal anti- Beta Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Rabbit polyclonal anti-PCYT2 Proteintech Cat# 14827-1-AP; RRID: AB_2159298 Rabbit polyclonal anti-HA tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Rabbit polyclonal anti-Flag tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Mouse monoclonal anti-GFP tag Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 Bacterial and virus strains E.coli HB101 DL-Stbl3 Tsingke Cat# DLC106 Biological samples Patient-derived xenografts (PDX) Prostate cancer tissue from the Second Xiangya Hospital N/A Chemicals, peptides, and recombinant proteins Dimethyl sulfoxide (DMSO) MedChemExpress Cat# 67-68-5 Palbociclib (PD-0332991) HCl Selleck Cat# S1116 Abemaciclib Selleck Cat# S5716 TK216 Selleck Cat# S9718 VL285 Selleck Cat# S0095 Phosphatidylcholines Selleck Cat# E7211 Free Fatty Acids (FFAs) 0.5 mM Sodium Oleate and 0.25 mM Sodium palmitate Kunchuang Biotechnology Cat# KT003-004 Lipofectamine 2000 reagent Thermo Fisher Cat# 11668019 Trizol Accurate Biotechnology Cat# AG21102 Critical commercial assays Cell Counting Kit-8 Beyotime Cat# C0037 EndoFree Plasmid Midi Kit CWBIO Cat# CW2105S ClonExpress II One Step Cloning Kit Vazyme Cat# C112-01 Evo M-MLV reverse transcription premix kit Accurate Cat# AG11728 SYBR Green Pro Taq HS premixed qPCR kit Accurate Cat# AG11701 Deposited data Raw and analyzed sequencing data This paper GEO: GSE266425; GSE266426; CNCB: OMIX010430;OMIX010431 Experimental models: Cell lines Human: 22Rv1 Yuchicell Biology Cat# SC0129 Human: C4-2 SUNNCELL Biotechnology Cat# SNL-160 Experimental models: Organisms/strains Mouse: BALB/c-nu/nu Hunan SJA Experimental Animal Company N/A Mouse: NOD-PrkdcscidIl2rgem1/Smoc (NSG) Shanghai model organisms Cat# NM-NSG-001 (Continued on next page) 16 Cell Reports 44, 116530, November 25, 2025 ..

other:

Article Title: A CD147-targeted small-molecule inhibitor potentiates gemcitabine efficacy by triggering ferroptosis in pancreatic ductal adenocarcinoma
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-CD147 Cell Signaling Technology Cat# 13287; RRID: AB_2798171 Rabbit monoclonal anti-SCD1 Cell Signaling Technology Cat# 2794; RRID: AB_2928123 Rabbit Polyclonal anti-CD147 Proteintech Cat# 11989-1-AP; RRID: AB_2290597 Rabbit Polyclonal anti-ACSL4 Proteintech Cat# 22401-1-AP; RRID: AB_2832995 Mouse monoclonal anti-GAPDH Proteintech Cat# 60004-1-Ig; RRID: AB_2107436 Rabbit Polyclonal anti-Alpha-Tubulin Proteintech Cat# 11224-1-AP; RRID: AB_2210206 Mouse monoclonal anti-Beta-Actin Solarbio Cat# K200058M; RRID: AB_3065784 Rabbit Polyclonal anti-Ki67 Abcam Cat# ab15580; RRID: AB_443209 Rabbit Polyclonal anti-Glutathione Peroxidase 4 Abcam Cat# ab41787; RRID: AB_941790 Rabbit Polyclonal anti-MCT1 Proteintech Cat# 20139-1-AP; RRID: AB_2878645 Rabbit Polyclonal anti-MCT4 Proteintech Cat# 22787-1-AP; RRID: AB_11182479 Rabbit Polyclonal anti-L-lactyllysine PTM BIO Cat# PTM-1401; RRID: AB_2868521 Rabbit Polyclonal anti-L-Lactyl-Histone H3 (Lys9) PTM BIO Cat# PTM-1419RM; RRID: AB_3076695 Rabbit Polyclonal anti-L-Lactyl-Histone H3 (Lys14) PTM BIO Cat# PTM-1414RM; RRID: AB_3076697 Rabbit Polyclonal anti-L-Lactyl-Histone H3 (Lys18) PTM BIO Cat# PTM-1427RM; RRID: AB_3076698 Rabbit Polyclonal anti-L-Lactyl-Histone H3 (Lys56) PTM BIO Cat# PTM-1421RM; RRID: AB_3076696 Rabbit Polyclonal anti-Histone-H3 Proteintech Cat# 17168-1-AP; RRID: AB_2716755 Rabbit Polyclonal anti-AMPK Alpha 1 Proteintech Cat# 10929-2-AP; RRID: AB_2169568 Rabbit Polyclonal anti-AMPK Alpha 1 (phospho S487) Abcam Cat# ab92701; RRID: AB_10562441 Rabbit Polyclonal anti-SREBF1 Proteintech Cat# 14088-1-AP; RRID: AB_2255217 Rabbit Polyclonal anti-ERK1/2 Proteintech Cat# 11257-1-AP; RRID: AB_2139822 Rabbit Polyclonal anti-Phospho-ERK1/2 (Thr202/Tyr204) Proteintech Cat# 80031-1-RR; RRID: AB_2918858 Rabbit Polyclonal anti-SLC7A11/xCT Proteintech Cat# 26864-1-AP; RRID: AB_2880661 Rabbit Polyclonal anti-AIFM2/FSP1 Proteintech Cat# 20886-1-AP; RRID: AB_2878756 Biological samples Pancreatic carcinomas tissue Pancreas Center, Tianjin Medical University Cancer Institute and Hospital N/A Human tissue microarrays of pancreatic carcinomas Pancreas Center, Tianjin Medical University Cancer Institute and Hospital N/A Patient-derived xenografts (PDX) Pancreas Center, Tianjin Medical University Cancer Institute and Hospital N/A Patient-derived organoid (PDO) Pancreas Center, Tianjin Medical University Cancer Institute and Hospital N/A (Continued on next page) e1 Cell Reports Medicine 6, 102292, August 19, 2025 Article ll OPEN ACCESS

Isolation:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Lysis:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

CCK-8 Assay:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

Article Title: Diet-metabolism-transcription axis modulates the sensitivity to CDK4/6 inhibitors through RB1 in prostate cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal anti-RB1 Proteintech Cat# 10048-2-Ig; RRID: AB_2177320 Rabbit polyclonal anti-Rb (phospho S795) Abcam Cat# ab47474 Rabbit polyclonal anti-p-Rb (phospho Ser249, Thr252) ThermoFisher scientific Cat# 44-548G Rabbit polyclonal anti-CDK4 Proteintech Cat# 11026-1-AP; RRID: AB_2078702 Rabbit polyclonal anti-CDK6 Proteintech Cat# 14052-1-AP; RRID: AB_10642144 Rabbit polyclonal anti-ETS1 Proteintech Cat# 12118-1-AP; RRID: AB_10664925 Rabbit polyclonal anti- Cleaved Caspase-3 Proteintech Cat# 25128-1-AP; RRID: AB_3073913 Rabbit polyclonal anti- Beta Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Rabbit polyclonal anti-PCYT2 Proteintech Cat# 14827-1-AP; RRID: AB_2159298 Rabbit polyclonal anti-HA tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Rabbit polyclonal anti-Flag tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Mouse monoclonal anti-GFP tag Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 Bacterial and virus strains E.coli HB101 DL-Stbl3 Tsingke Cat# DLC106 Biological samples Patient-derived xenografts (PDX) Prostate cancer tissue from the Second Xiangya Hospital N/A Chemicals, peptides, and recombinant proteins Dimethyl sulfoxide (DMSO) MedChemExpress Cat# 67-68-5 Palbociclib (PD-0332991) HCl Selleck Cat# S1116 Abemaciclib Selleck Cat# S5716 TK216 Selleck Cat# S9718 VL285 Selleck Cat# S0095 Phosphatidylcholines Selleck Cat# E7211 Free Fatty Acids (FFAs) 0.5 mM Sodium Oleate and 0.25 mM Sodium palmitate Kunchuang Biotechnology Cat# KT003-004 Lipofectamine 2000 reagent Thermo Fisher Cat# 11668019 Trizol Accurate Biotechnology Cat# AG21102 Critical commercial assays Cell Counting Kit-8 Beyotime Cat# C0037 EndoFree Plasmid Midi Kit CWBIO Cat# CW2105S ClonExpress II One Step Cloning Kit Vazyme Cat# C112-01 Evo M-MLV reverse transcription premix kit Accurate Cat# AG11728 SYBR Green Pro Taq HS premixed qPCR kit Accurate Cat# AG11701 Deposited data Raw and analyzed sequencing data This paper GEO: GSE266425; GSE266426; CNCB: OMIX010430;OMIX010431 Experimental models: Cell lines Human: 22Rv1 Yuchicell Biology Cat# SC0129 Human: C4-2 SUNNCELL Biotechnology Cat# SNL-160 Experimental models: Organisms/strains Mouse: BALB/c-nu/nu Hunan SJA Experimental Animal Company N/A Mouse: NOD-PrkdcscidIl2rgem1/Smoc (NSG) Shanghai model organisms Cat# NM-NSG-001 (Continued on next page) 16 Cell Reports 44, 116530, November 25, 2025 ..

Cell Counting:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Staining:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Magnetic Beads:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Polymerase Chain Reaction:

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

BIA-KA:

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

RNA Extraction:

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

SYBR Green Assay:

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

Article Title: Diet-metabolism-transcription axis modulates the sensitivity to CDK4/6 inhibitors through RB1 in prostate cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal anti-RB1 Proteintech Cat# 10048-2-Ig; RRID: AB_2177320 Rabbit polyclonal anti-Rb (phospho S795) Abcam Cat# ab47474 Rabbit polyclonal anti-p-Rb (phospho Ser249, Thr252) ThermoFisher scientific Cat# 44-548G Rabbit polyclonal anti-CDK4 Proteintech Cat# 11026-1-AP; RRID: AB_2078702 Rabbit polyclonal anti-CDK6 Proteintech Cat# 14052-1-AP; RRID: AB_10642144 Rabbit polyclonal anti-ETS1 Proteintech Cat# 12118-1-AP; RRID: AB_10664925 Rabbit polyclonal anti- Cleaved Caspase-3 Proteintech Cat# 25128-1-AP; RRID: AB_3073913 Rabbit polyclonal anti- Beta Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Rabbit polyclonal anti-PCYT2 Proteintech Cat# 14827-1-AP; RRID: AB_2159298 Rabbit polyclonal anti-HA tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Rabbit polyclonal anti-Flag tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Mouse monoclonal anti-GFP tag Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 Bacterial and virus strains E.coli HB101 DL-Stbl3 Tsingke Cat# DLC106 Biological samples Patient-derived xenografts (PDX) Prostate cancer tissue from the Second Xiangya Hospital N/A Chemicals, peptides, and recombinant proteins Dimethyl sulfoxide (DMSO) MedChemExpress Cat# 67-68-5 Palbociclib (PD-0332991) HCl Selleck Cat# S1116 Abemaciclib Selleck Cat# S5716 TK216 Selleck Cat# S9718 VL285 Selleck Cat# S0095 Phosphatidylcholines Selleck Cat# E7211 Free Fatty Acids (FFAs) 0.5 mM Sodium Oleate and 0.25 mM Sodium palmitate Kunchuang Biotechnology Cat# KT003-004 Lipofectamine 2000 reagent Thermo Fisher Cat# 11668019 Trizol Accurate Biotechnology Cat# AG21102 Critical commercial assays Cell Counting Kit-8 Beyotime Cat# C0037 EndoFree Plasmid Midi Kit CWBIO Cat# CW2105S ClonExpress II One Step Cloning Kit Vazyme Cat# C112-01 Evo M-MLV reverse transcription premix kit Accurate Cat# AG11728 SYBR Green Pro Taq HS premixed qPCR kit Accurate Cat# AG11701 Deposited data Raw and analyzed sequencing data This paper GEO: GSE266425; GSE266426; CNCB: OMIX010430;OMIX010431 Experimental models: Cell lines Human: 22Rv1 Yuchicell Biology Cat# SC0129 Human: C4-2 SUNNCELL Biotechnology Cat# SNL-160 Experimental models: Organisms/strains Mouse: BALB/c-nu/nu Hunan SJA Experimental Animal Company N/A Mouse: NOD-PrkdcscidIl2rgem1/Smoc (NSG) Shanghai model organisms Cat# NM-NSG-001 (Continued on next page) 16 Cell Reports 44, 116530, November 25, 2025 ..

Real-time Polymerase Chain Reaction:

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

Article Title: Diet-metabolism-transcription axis modulates the sensitivity to CDK4/6 inhibitors through RB1 in prostate cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal anti-RB1 Proteintech Cat# 10048-2-Ig; RRID: AB_2177320 Rabbit polyclonal anti-Rb (phospho S795) Abcam Cat# ab47474 Rabbit polyclonal anti-p-Rb (phospho Ser249, Thr252) ThermoFisher scientific Cat# 44-548G Rabbit polyclonal anti-CDK4 Proteintech Cat# 11026-1-AP; RRID: AB_2078702 Rabbit polyclonal anti-CDK6 Proteintech Cat# 14052-1-AP; RRID: AB_10642144 Rabbit polyclonal anti-ETS1 Proteintech Cat# 12118-1-AP; RRID: AB_10664925 Rabbit polyclonal anti- Cleaved Caspase-3 Proteintech Cat# 25128-1-AP; RRID: AB_3073913 Rabbit polyclonal anti- Beta Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Rabbit polyclonal anti-PCYT2 Proteintech Cat# 14827-1-AP; RRID: AB_2159298 Rabbit polyclonal anti-HA tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Rabbit polyclonal anti-Flag tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Mouse monoclonal anti-GFP tag Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 Bacterial and virus strains E.coli HB101 DL-Stbl3 Tsingke Cat# DLC106 Biological samples Patient-derived xenografts (PDX) Prostate cancer tissue from the Second Xiangya Hospital N/A Chemicals, peptides, and recombinant proteins Dimethyl sulfoxide (DMSO) MedChemExpress Cat# 67-68-5 Palbociclib (PD-0332991) HCl Selleck Cat# S1116 Abemaciclib Selleck Cat# S5716 TK216 Selleck Cat# S9718 VL285 Selleck Cat# S0095 Phosphatidylcholines Selleck Cat# E7211 Free Fatty Acids (FFAs) 0.5 mM Sodium Oleate and 0.25 mM Sodium palmitate Kunchuang Biotechnology Cat# KT003-004 Lipofectamine 2000 reagent Thermo Fisher Cat# 11668019 Trizol Accurate Biotechnology Cat# AG21102 Critical commercial assays Cell Counting Kit-8 Beyotime Cat# C0037 EndoFree Plasmid Midi Kit CWBIO Cat# CW2105S ClonExpress II One Step Cloning Kit Vazyme Cat# C112-01 Evo M-MLV reverse transcription premix kit Accurate Cat# AG11728 SYBR Green Pro Taq HS premixed qPCR kit Accurate Cat# AG11701 Deposited data Raw and analyzed sequencing data This paper GEO: GSE266425; GSE266426; CNCB: OMIX010430;OMIX010431 Experimental models: Cell lines Human: 22Rv1 Yuchicell Biology Cat# SC0129 Human: C4-2 SUNNCELL Biotechnology Cat# SNL-160 Experimental models: Organisms/strains Mouse: BALB/c-nu/nu Hunan SJA Experimental Animal Company N/A Mouse: NOD-PrkdcscidIl2rgem1/Smoc (NSG) Shanghai model organisms Cat# NM-NSG-001 (Continued on next page) 16 Cell Reports 44, 116530, November 25, 2025 ..

Luciferase:

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

Reporter Gene Assay:

Article Title: Gut-microbiota-derived 3-indoleacrylic acid alleviates neonatal necrotizing enterocolitis by inhibiting epithelial necroptosis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-RIPK3 antibody Proteintech Cat# 17563-1-AP; RRID: AB_2178659 Anti-FABP2 antibody Proteintech Cat# 67691-1-Ig; RRID: AB_2882884 Anti-MLKL antibody Proteintech Cat# 66675-1-Ig; RRID: AB_2882029 Anti-STAT1 antibody Proteintech Cat# 82016-1-RR; RRID: AB_2935597 Anti-RIP3 (phospho S232) antibody Abcam Cat# ab195117; RRID: AB_2768156 Anti-MLKL (phospho S345) antibody Abcam Cat# AB196436; RRID: AB_2687465 Anti-NF-kB p65 (phospho S536) antibody Abcam Cat# ab76302; RRID: AB_1524028 Anti-NF-kB p65/RelA antibody Abclonal Cat# A19653; RRID: AB_2862717 Anti-STAT1 (Phospho S727) Abclonal Cat# AP1000; RRID: AB_2863892 Anti-SOCS5 antibody Affinity Cat# DF14151; RRID: AB_3717975 STAT1 (for CUT&Tag) Selleck Cat# F0263; RRID: AB_3717976 Anti-GAPDH antibody Bioworld Biotech Cat# AP0063; RRID: AB_2651132 goat anti-rabbit cy3 secondary antibodies Abcam Cat# ab6939; RRID: AB_955021 Mouse IgG Aladdin Cat# Ab170221; RRID: AB_3717977 Goat Anti-Human IgG, Fcγ fragment specific, HRP conjugated-second antibody CUSABIO Cat# CSB-PA160506; RRID: AB_3717978 Bacterial and virus strains Bifidobacterium longum subsp. Infantis JCM11660 Mingzhou Biotech Cat# BMZ010548 Bifidobacterium longum subsp. Infantis EVC001 Infinant Health Inc. N/A Biological samples Fecal samples from 42 neonates the Neonatology Department of Wuxi Children’s Hospital http://www.wxchildren.com/ Chemicals, peptides, and recombinant proteins IA MedChemExpress Cat# HY-W015273 CH-223191 MedChemExpress Cat# HY-12684 TNBS Sigma-Aldrich Cat# P2297 TSZ Beyotime Biotechnology Cat# C1058S DAPI Solarbio Cat# C0065 MES buffer Macklin Cat# M885671 NHS Macklin Cat# H6231 EDC Picasso Cat# BJS2544046 biotin-PEG2-amine Macklin Cat# B863624 Recombinant Human Aryl hydrocarbon receptor (AHR), partial CUSABIO Cat# CSB-EP001481HU6 Critical commercial assays TransDetect® PCR Mycoplasma Detection Kit Transgen Biotech Cat# FM3-11-01 BCA assay meilunbio Cat# MA0082-2 RNA extraction kit Yeasen Biotechnology Cat# 19202ES60 All-in-One RT Premix Kit Vazyme Cat# R333-01 SYBR Green qPCR Master Mix Vazyme Cat# Q711-02 Cell Counting Kit-8 Abbkine Cat# BMU106 Dual Luciferase Reporter Gene Assay Kit Beyotime Cat# RG027 (Continued on next page) e1 Cell Reports Medicine 7, 102721, April 21, 2026 OPEN ACCESS ..

Plasmid Preparation:

Article Title: Diet-metabolism-transcription axis modulates the sensitivity to CDK4/6 inhibitors through RB1 in prostate cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal anti-RB1 Proteintech Cat# 10048-2-Ig; RRID: AB_2177320 Rabbit polyclonal anti-Rb (phospho S795) Abcam Cat# ab47474 Rabbit polyclonal anti-p-Rb (phospho Ser249, Thr252) ThermoFisher scientific Cat# 44-548G Rabbit polyclonal anti-CDK4 Proteintech Cat# 11026-1-AP; RRID: AB_2078702 Rabbit polyclonal anti-CDK6 Proteintech Cat# 14052-1-AP; RRID: AB_10642144 Rabbit polyclonal anti-ETS1 Proteintech Cat# 12118-1-AP; RRID: AB_10664925 Rabbit polyclonal anti- Cleaved Caspase-3 Proteintech Cat# 25128-1-AP; RRID: AB_3073913 Rabbit polyclonal anti- Beta Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Rabbit polyclonal anti-PCYT2 Proteintech Cat# 14827-1-AP; RRID: AB_2159298 Rabbit polyclonal anti-HA tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Rabbit polyclonal anti-Flag tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Mouse monoclonal anti-GFP tag Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 Bacterial and virus strains E.coli HB101 DL-Stbl3 Tsingke Cat# DLC106 Biological samples Patient-derived xenografts (PDX) Prostate cancer tissue from the Second Xiangya Hospital N/A Chemicals, peptides, and recombinant proteins Dimethyl sulfoxide (DMSO) MedChemExpress Cat# 67-68-5 Palbociclib (PD-0332991) HCl Selleck Cat# S1116 Abemaciclib Selleck Cat# S5716 TK216 Selleck Cat# S9718 VL285 Selleck Cat# S0095 Phosphatidylcholines Selleck Cat# E7211 Free Fatty Acids (FFAs) 0.5 mM Sodium Oleate and 0.25 mM Sodium palmitate Kunchuang Biotechnology Cat# KT003-004 Lipofectamine 2000 reagent Thermo Fisher Cat# 11668019 Trizol Accurate Biotechnology Cat# AG21102 Critical commercial assays Cell Counting Kit-8 Beyotime Cat# C0037 EndoFree Plasmid Midi Kit CWBIO Cat# CW2105S ClonExpress II One Step Cloning Kit Vazyme Cat# C112-01 Evo M-MLV reverse transcription premix kit Accurate Cat# AG11728 SYBR Green Pro Taq HS premixed qPCR kit Accurate Cat# AG11701 Deposited data Raw and analyzed sequencing data This paper GEO: GSE266425; GSE266426; CNCB: OMIX010430;OMIX010431 Experimental models: Cell lines Human: 22Rv1 Yuchicell Biology Cat# SC0129 Human: C4-2 SUNNCELL Biotechnology Cat# SNL-160 Experimental models: Organisms/strains Mouse: BALB/c-nu/nu Hunan SJA Experimental Animal Company N/A Mouse: NOD-PrkdcscidIl2rgem1/Smoc (NSG) Shanghai model organisms Cat# NM-NSG-001 (Continued on next page) 16 Cell Reports 44, 116530, November 25, 2025 ..

Cloning:

Article Title: Diet-metabolism-transcription axis modulates the sensitivity to CDK4/6 inhibitors through RB1 in prostate cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal anti-RB1 Proteintech Cat# 10048-2-Ig; RRID: AB_2177320 Rabbit polyclonal anti-Rb (phospho S795) Abcam Cat# ab47474 Rabbit polyclonal anti-p-Rb (phospho Ser249, Thr252) ThermoFisher scientific Cat# 44-548G Rabbit polyclonal anti-CDK4 Proteintech Cat# 11026-1-AP; RRID: AB_2078702 Rabbit polyclonal anti-CDK6 Proteintech Cat# 14052-1-AP; RRID: AB_10642144 Rabbit polyclonal anti-ETS1 Proteintech Cat# 12118-1-AP; RRID: AB_10664925 Rabbit polyclonal anti- Cleaved Caspase-3 Proteintech Cat# 25128-1-AP; RRID: AB_3073913 Rabbit polyclonal anti- Beta Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Rabbit polyclonal anti-PCYT2 Proteintech Cat# 14827-1-AP; RRID: AB_2159298 Rabbit polyclonal anti-HA tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Rabbit polyclonal anti-Flag tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Mouse monoclonal anti-GFP tag Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 Bacterial and virus strains E.coli HB101 DL-Stbl3 Tsingke Cat# DLC106 Biological samples Patient-derived xenografts (PDX) Prostate cancer tissue from the Second Xiangya Hospital N/A Chemicals, peptides, and recombinant proteins Dimethyl sulfoxide (DMSO) MedChemExpress Cat# 67-68-5 Palbociclib (PD-0332991) HCl Selleck Cat# S1116 Abemaciclib Selleck Cat# S5716 TK216 Selleck Cat# S9718 VL285 Selleck Cat# S0095 Phosphatidylcholines Selleck Cat# E7211 Free Fatty Acids (FFAs) 0.5 mM Sodium Oleate and 0.25 mM Sodium palmitate Kunchuang Biotechnology Cat# KT003-004 Lipofectamine 2000 reagent Thermo Fisher Cat# 11668019 Trizol Accurate Biotechnology Cat# AG21102 Critical commercial assays Cell Counting Kit-8 Beyotime Cat# C0037 EndoFree Plasmid Midi Kit CWBIO Cat# CW2105S ClonExpress II One Step Cloning Kit Vazyme Cat# C112-01 Evo M-MLV reverse transcription premix kit Accurate Cat# AG11728 SYBR Green Pro Taq HS premixed qPCR kit Accurate Cat# AG11701 Deposited data Raw and analyzed sequencing data This paper GEO: GSE266425; GSE266426; CNCB: OMIX010430;OMIX010431 Experimental models: Cell lines Human: 22Rv1 Yuchicell Biology Cat# SC0129 Human: C4-2 SUNNCELL Biotechnology Cat# SNL-160 Experimental models: Organisms/strains Mouse: BALB/c-nu/nu Hunan SJA Experimental Animal Company N/A Mouse: NOD-PrkdcscidIl2rgem1/Smoc (NSG) Shanghai model organisms Cat# NM-NSG-001 (Continued on next page) 16 Cell Reports 44, 116530, November 25, 2025 ..

Reverse Transcription:

Article Title: Diet-metabolism-transcription axis modulates the sensitivity to CDK4/6 inhibitors through RB1 in prostate cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal anti-RB1 Proteintech Cat# 10048-2-Ig; RRID: AB_2177320 Rabbit polyclonal anti-Rb (phospho S795) Abcam Cat# ab47474 Rabbit polyclonal anti-p-Rb (phospho Ser249, Thr252) ThermoFisher scientific Cat# 44-548G Rabbit polyclonal anti-CDK4 Proteintech Cat# 11026-1-AP; RRID: AB_2078702 Rabbit polyclonal anti-CDK6 Proteintech Cat# 14052-1-AP; RRID: AB_10642144 Rabbit polyclonal anti-ETS1 Proteintech Cat# 12118-1-AP; RRID: AB_10664925 Rabbit polyclonal anti- Cleaved Caspase-3 Proteintech Cat# 25128-1-AP; RRID: AB_3073913 Rabbit polyclonal anti- Beta Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Rabbit polyclonal anti-PCYT2 Proteintech Cat# 14827-1-AP; RRID: AB_2159298 Rabbit polyclonal anti-HA tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Rabbit polyclonal anti-Flag tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Mouse monoclonal anti-GFP tag Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 Bacterial and virus strains E.coli HB101 DL-Stbl3 Tsingke Cat# DLC106 Biological samples Patient-derived xenografts (PDX) Prostate cancer tissue from the Second Xiangya Hospital N/A Chemicals, peptides, and recombinant proteins Dimethyl sulfoxide (DMSO) MedChemExpress Cat# 67-68-5 Palbociclib (PD-0332991) HCl Selleck Cat# S1116 Abemaciclib Selleck Cat# S5716 TK216 Selleck Cat# S9718 VL285 Selleck Cat# S0095 Phosphatidylcholines Selleck Cat# E7211 Free Fatty Acids (FFAs) 0.5 mM Sodium Oleate and 0.25 mM Sodium palmitate Kunchuang Biotechnology Cat# KT003-004 Lipofectamine 2000 reagent Thermo Fisher Cat# 11668019 Trizol Accurate Biotechnology Cat# AG21102 Critical commercial assays Cell Counting Kit-8 Beyotime Cat# C0037 EndoFree Plasmid Midi Kit CWBIO Cat# CW2105S ClonExpress II One Step Cloning Kit Vazyme Cat# C112-01 Evo M-MLV reverse transcription premix kit Accurate Cat# AG11728 SYBR Green Pro Taq HS premixed qPCR kit Accurate Cat# AG11701 Deposited data Raw and analyzed sequencing data This paper GEO: GSE266425; GSE266426; CNCB: OMIX010430;OMIX010431 Experimental models: Cell lines Human: 22Rv1 Yuchicell Biology Cat# SC0129 Human: C4-2 SUNNCELL Biotechnology Cat# SNL-160 Experimental models: Organisms/strains Mouse: BALB/c-nu/nu Hunan SJA Experimental Animal Company N/A Mouse: NOD-PrkdcscidIl2rgem1/Smoc (NSG) Shanghai model organisms Cat# NM-NSG-001 (Continued on next page) 16 Cell Reports 44, 116530, November 25, 2025 ..

Sequencing:

Article Title: Diet-metabolism-transcription axis modulates the sensitivity to CDK4/6 inhibitors through RB1 in prostate cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Polyclonal anti-RB1 Proteintech Cat# 10048-2-Ig; RRID: AB_2177320 Rabbit polyclonal anti-Rb (phospho S795) Abcam Cat# ab47474 Rabbit polyclonal anti-p-Rb (phospho Ser249, Thr252) ThermoFisher scientific Cat# 44-548G Rabbit polyclonal anti-CDK4 Proteintech Cat# 11026-1-AP; RRID: AB_2078702 Rabbit polyclonal anti-CDK6 Proteintech Cat# 14052-1-AP; RRID: AB_10642144 Rabbit polyclonal anti-ETS1 Proteintech Cat# 12118-1-AP; RRID: AB_10664925 Rabbit polyclonal anti- Cleaved Caspase-3 Proteintech Cat# 25128-1-AP; RRID: AB_3073913 Rabbit polyclonal anti- Beta Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Rabbit polyclonal anti-PCYT2 Proteintech Cat# 14827-1-AP; RRID: AB_2159298 Rabbit polyclonal anti-HA tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Rabbit polyclonal anti-Flag tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Mouse monoclonal anti-GFP tag Proteintech Cat# 66002-1-Ig; RRID: AB_11182611 Bacterial and virus strains E.coli HB101 DL-Stbl3 Tsingke Cat# DLC106 Biological samples Patient-derived xenografts (PDX) Prostate cancer tissue from the Second Xiangya Hospital N/A Chemicals, peptides, and recombinant proteins Dimethyl sulfoxide (DMSO) MedChemExpress Cat# 67-68-5 Palbociclib (PD-0332991) HCl Selleck Cat# S1116 Abemaciclib Selleck Cat# S5716 TK216 Selleck Cat# S9718 VL285 Selleck Cat# S0095 Phosphatidylcholines Selleck Cat# E7211 Free Fatty Acids (FFAs) 0.5 mM Sodium Oleate and 0.25 mM Sodium palmitate Kunchuang Biotechnology Cat# KT003-004 Lipofectamine 2000 reagent Thermo Fisher Cat# 11668019 Trizol Accurate Biotechnology Cat# AG21102 Critical commercial assays Cell Counting Kit-8 Beyotime Cat# C0037 EndoFree Plasmid Midi Kit CWBIO Cat# CW2105S ClonExpress II One Step Cloning Kit Vazyme Cat# C112-01 Evo M-MLV reverse transcription premix kit Accurate Cat# AG11728 SYBR Green Pro Taq HS premixed qPCR kit Accurate Cat# AG11701 Deposited data Raw and analyzed sequencing data This paper GEO: GSE266425; GSE266426; CNCB: OMIX010430;OMIX010431 Experimental models: Cell lines Human: 22Rv1 Yuchicell Biology Cat# SC0129 Human: C4-2 SUNNCELL Biotechnology Cat# SNL-160 Experimental models: Organisms/strains Mouse: BALB/c-nu/nu Hunan SJA Experimental Animal Company N/A Mouse: NOD-PrkdcscidIl2rgem1/Smoc (NSG) Shanghai model organisms Cat# NM-NSG-001 (Continued on next page) 16 Cell Reports 44, 116530, November 25, 2025 ..



Similar Products

94
MedChemExpress ethyl e
Ethyl E, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/RR-11a/bio_rxiv__64898__2026__07__20__739492-48-8-22
Average 94 stars, based on 1 article reviews
ethyl e - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

96
Proteintech gst tag
USP20 directly interacts with GPX4. ( A ) Immunoblot analysis of target proteins in sorafenib-resistant 769-P and A549 cells following 24 h treatment with specific deubiquitinase inhibitors. ML-323: 10 μM, GSK2643943A: 10 μM, XL177A: 10 μM, Spautin-1: 10 μM, IU1: 10 μM, AZ1: 10 μM, MF-094: 10 μM, LDN-57444: 10 μM, TCID: 10 μM, PR-619: 10 μM, BAY11-7082: 10 μM, EOAI3402143: 2.5 μM, ML364: 10 μM, b-AP15: 0.5 μM. ( B ) HEK293T cells were transfected with <t>GST-GPX4</t> <t>and</t> <t>Flag-USP.</t> The cell lysate was applied with GST pull-down, then analyzed with immunoblot for indicated proteins. ( C ) 769-P and A549 cells were subjected to immunoprecipitate with anti-GPX4 antibodies, then analyzed with immunoblot for indicated proteins. ( D ) Overview of USP20 structures. ( E-F ) HEK293T cells transfected with the indicated USP20 structures and Flag-GPX4 were subjected to pull-down with GSH beads or immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( G ) 769-P and A549 cells were subjected to subcellular fractionation, then analyzed with immunoblot for indicated proteins. ( H ) Overview of GPX4 isoforms structures. ( I ) HEK293T cells transfected with the indicated GPX4 isoforms and GST-USP20 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( J ) HEK293T cells transfected with the GST-USP20 WT/C154S and Flag-GPX4 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins.
Gst Tag, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/GST+Tag+Antibody/pmc13010945-36-17-66
Average 96 stars, based on 1 article reviews
gst tag - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Proteintech rabbit anti calr
USP20 directly interacts with GPX4. ( A ) Immunoblot analysis of target proteins in sorafenib-resistant 769-P and A549 cells following 24 h treatment with specific deubiquitinase inhibitors. ML-323: 10 μM, GSK2643943A: 10 μM, XL177A: 10 μM, Spautin-1: 10 μM, IU1: 10 μM, AZ1: 10 μM, MF-094: 10 μM, LDN-57444: 10 μM, TCID: 10 μM, PR-619: 10 μM, BAY11-7082: 10 μM, EOAI3402143: 2.5 μM, ML364: 10 μM, b-AP15: 0.5 μM. ( B ) HEK293T cells were transfected with <t>GST-GPX4</t> <t>and</t> <t>Flag-USP.</t> The cell lysate was applied with GST pull-down, then analyzed with immunoblot for indicated proteins. ( C ) 769-P and A549 cells were subjected to immunoprecipitate with anti-GPX4 antibodies, then analyzed with immunoblot for indicated proteins. ( D ) Overview of USP20 structures. ( E-F ) HEK293T cells transfected with the indicated USP20 structures and Flag-GPX4 were subjected to pull-down with GSH beads or immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( G ) 769-P and A549 cells were subjected to subcellular fractionation, then analyzed with immunoblot for indicated proteins. ( H ) Overview of GPX4 isoforms structures. ( I ) HEK293T cells transfected with the indicated GPX4 isoforms and GST-USP20 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( J ) HEK293T cells transfected with the GST-USP20 WT/C154S and Flag-GPX4 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins.
Rabbit Anti Calr, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/calreticulin+Antibody/pm41932312-325-53-56
Average 96 stars, based on 1 article reviews
rabbit anti calr - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Proteintech fitc
USP20 directly interacts with GPX4. ( A ) Immunoblot analysis of target proteins in sorafenib-resistant 769-P and A549 cells following 24 h treatment with specific deubiquitinase inhibitors. ML-323: 10 μM, GSK2643943A: 10 μM, XL177A: 10 μM, Spautin-1: 10 μM, IU1: 10 μM, AZ1: 10 μM, MF-094: 10 μM, LDN-57444: 10 μM, TCID: 10 μM, PR-619: 10 μM, BAY11-7082: 10 μM, EOAI3402143: 2.5 μM, ML364: 10 μM, b-AP15: 0.5 μM. ( B ) HEK293T cells were transfected with <t>GST-GPX4</t> <t>and</t> <t>Flag-USP.</t> The cell lysate was applied with GST pull-down, then analyzed with immunoblot for indicated proteins. ( C ) 769-P and A549 cells were subjected to immunoprecipitate with anti-GPX4 antibodies, then analyzed with immunoblot for indicated proteins. ( D ) Overview of USP20 structures. ( E-F ) HEK293T cells transfected with the indicated USP20 structures and Flag-GPX4 were subjected to pull-down with GSH beads or immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( G ) 769-P and A549 cells were subjected to subcellular fractionation, then analyzed with immunoblot for indicated proteins. ( H ) Overview of GPX4 isoforms structures. ( I ) HEK293T cells transfected with the indicated GPX4 isoforms and GST-USP20 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( J ) HEK293T cells transfected with the GST-USP20 WT/C154S and Flag-GPX4 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins.
Fitc, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/FITC+Antibody/pm41935577-197-17-20
Average 96 stars, based on 1 article reviews
fitc - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Proteintech anti p38
Metabolic regulation of nucleus pulposus vells by SIN and DAB through MAPK and NF-κB pathways. (A) Volcano plot analysis of DE genes (TNF-α vs. TNF-α+SIN). (B) KEGG enrichment analysis of DE genes (TNF-α vs. TNF-α+SIN). (C) GSEA indicated MAPK signalling pathway enrichment. (D) Heatmap of ten selected differentially expressed genes (TNF-α vs. TNF-α+SIN). (E) Western blot analysis of key proteins in the MAPK signalling pathway (p-ERK, p-JNK, <t>p-p38,</t> ERK, JNK, and p38) in the different treatment groups. (F) Quantitative analysis of the Western blot data for MAPK signalling pathway proteins. (G–H) Western blot and quantitative analysis of p-ERK, p-JNK, p-p38, ERK, JNK, and p38 treated with or without TNF-α in the absence or presence of SIN (10 μM) (PCDNA 3.1 vs. TNFR1-OE).(I–L) Integrated analysis of TNF-α vs. TNF-α+DAB DEGs: Volcano plot of DE genes (significance/fold change), KEGG pathway enrichment of DE genes, NF-κB signalling enrichment in GSEA, and heatmap of ten selected differentially expressed genes. (M) Western blot analysis of key proteins in the NF-κB signalling pathway (p-IκBα, p-p65, IκBα, and p65) in the different treatment groups. (N) Quantitative analysis of the Western blot data for the NF-κB signalling pathway proteins. (O–P) Western blot and quantitative analysis of p-p65 and p65 (PCDNA 3.1 vs. TNFR1-OE). (Q) Matched diagram of b and y ions. (R) Western blot analysis of RELA in the different treatment groups. (S) Western blot analysis confirmed the stabilization of p65 by DAB. (T) The affinity between DAB and the p65 target protein was estimated after incubation at different temperatures via Western blot analysis. (n = 3; ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001).
Anti P38, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/Phospho-JNK+(Tyr185)+Recombinant+antibody/pmc12874112-153-67-65
Average 96 stars, based on 1 article reviews
anti p38 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Proteintech antibodies against α sma
Metabolic regulation of nucleus pulposus vells by SIN and DAB through MAPK and NF-κB pathways. (A) Volcano plot analysis of DE genes (TNF-α vs. TNF-α+SIN). (B) KEGG enrichment analysis of DE genes (TNF-α vs. TNF-α+SIN). (C) GSEA indicated MAPK signalling pathway enrichment. (D) Heatmap of ten selected differentially expressed genes (TNF-α vs. TNF-α+SIN). (E) Western blot analysis of key proteins in the MAPK signalling pathway (p-ERK, p-JNK, <t>p-p38,</t> ERK, JNK, and p38) in the different treatment groups. (F) Quantitative analysis of the Western blot data for MAPK signalling pathway proteins. (G–H) Western blot and quantitative analysis of p-ERK, p-JNK, p-p38, ERK, JNK, and p38 treated with or without TNF-α in the absence or presence of SIN (10 μM) (PCDNA 3.1 vs. TNFR1-OE).(I–L) Integrated analysis of TNF-α vs. TNF-α+DAB DEGs: Volcano plot of DE genes (significance/fold change), KEGG pathway enrichment of DE genes, NF-κB signalling enrichment in GSEA, and heatmap of ten selected differentially expressed genes. (M) Western blot analysis of key proteins in the NF-κB signalling pathway (p-IκBα, p-p65, IκBα, and p65) in the different treatment groups. (N) Quantitative analysis of the Western blot data for the NF-κB signalling pathway proteins. (O–P) Western blot and quantitative analysis of p-p65 and p65 (PCDNA 3.1 vs. TNFR1-OE). (Q) Matched diagram of b and y ions. (R) Western blot analysis of RELA in the different treatment groups. (S) Western blot analysis confirmed the stabilization of p65 by DAB. (T) The affinity between DAB and the p65 target protein was estimated after incubation at different temperatures via Western blot analysis. (n = 3; ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001).
Antibodies Against α Sma, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/smooth+muscle+actin-specific+Antibody/pm41932595-124-22-26
Average 96 stars, based on 1 article reviews
antibodies against α sma - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Proteintech gst
PIM1 directly interacts with DDX41 and regulates its phosphorylation. ( A ) HCECs transfected with either pcDNA3.1 (Flag) or pcDNA3.1 PIM1 (Flag-PIM1) were stimulated with A. fumigatus hyphae (1 × 10 6 hyphal fragments/mL) for 12 hours. Cell lysates were immunoprecipitated using anti-Flag beads, and bound proteins were separated by SDS-PAGE and visualized by silver staining. ( B ) A <t>GST</t> pull-down assay was performed to examine direct binding between PIM1 and DDX41. ( C ) Endogenous interaction between PIM1 and DDX41 in HCECs was assessed by co-IP. HEK293T cells were cotransfected with Flag-PIM1 and Myc-DDX41 for 48 hours. (D) Co-IP was carried out with anti-Flag beads, and Myc-DDX41 was detected with anti-Myc antibody. ( E ) Reciprocal co-IP was performed using anti-Myc beads, and Flag-PIM1 was probed with anti-Flag antibody. ( F ) HCECs were transfected with NC siRNA (siNC) or PIM1 siRNAs (siPIM1-1 and siPIM1-2) for 24 hours, then exposed to A. fumigatus hyphae for 12 hours. DDX41 was immunoprecipitated and immunoblotted with anti–p-Ser and <t>DDX41</t> <t>antibodies.</t> ( G ) HCECs were transfected with pcDNA3.1 (Vector) or pcDNA3.1-PIM1 (PIM1) for 24 hours, then exposed to A. fumigatus hyphae for 12 hours, followed by DDX41 immunoprecipitation and immunoblotting with indicated antibodies. ( H ) HCECs were transfected with NC siRNA (siNC), PIM1 siRNA (siPIM1-2), and/or pcDNA3.1-PIM1 (PIM1) for 24 hours, then treated with A. fumigatus hyphae for 12 hours. Co-IP of DDX41 was performed, and associated proteins were analyzed by Western blot. ( I ) Quantification of protein levels in ( H ). ( J ) HCECs were pretreated with SGI-1776 (0 and 4 µM) for 12 hours prior to 12-hour stimulation with A. fumigatus hyphae. Co-IP assay was performed using anti-DDX41 antibody and immunoblotted with the antibodies indicated. ( K ) Quantification of protein levels in ( J ). ( L ) Recombinant His-PIM1 and GST-DDX41 were incubated in reaction buffer with or without phosphatase for 30 minutes. The protein levels of p-Ser, His-PIM1, and GST-DDX41 were detected by Western blot. Quantification of protein levels in F, G, and L is shown in A–C. Data are presented as the mean ± SD; ** P < 0.01; n = 3.
Gst, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/GST+Tag+Antibody/pmc13050013-35-11-36
Average 96 stars, based on 1 article reviews
gst - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Proteintech crt
The anti-tumor immune mechanism of ICCP NPs. a) Schematic illustration of cuproptosis mechanism. b) Immunofluorescence analysis of DLAT and FDX1 in 4T1 cells following various treatments. c) Schematic diagram illustrating the synergistic induction of ICD by SDT and cuproptosis. d) Immunofluorescence analysis of <t>CRT</t> and HMGB1 in 4T1 cells following various treatments. e) Quantitative analysis of CRT fluorescence intensity. f) ATP content in 4T1 cells following various treatments.
Crt, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/calreticulin+Antibody/pmc12966914-98-20-27
Average 96 stars, based on 1 article reviews
crt - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Proteintech fluorescein fitc conjugated goat anti rat igg
The anti-tumor immune mechanism of ICCP NPs. a) Schematic illustration of cuproptosis mechanism. b) Immunofluorescence analysis of DLAT and FDX1 in 4T1 cells following various treatments. c) Schematic diagram illustrating the synergistic induction of ICD by SDT and cuproptosis. d) Immunofluorescence analysis of <t>CRT</t> and HMGB1 in 4T1 cells following various treatments. e) Quantitative analysis of CRT fluorescence intensity. f) ATP content in 4T1 cells following various treatments.
Fluorescein Fitc Conjugated Goat Anti Rat Igg, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/1+rr/FITC+Antibody/pmc12771358-606-0-9
Average 96 stars, based on 1 article reviews
fluorescein fitc conjugated goat anti rat igg - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


USP20 directly interacts with GPX4. ( A ) Immunoblot analysis of target proteins in sorafenib-resistant 769-P and A549 cells following 24 h treatment with specific deubiquitinase inhibitors. ML-323: 10 μM, GSK2643943A: 10 μM, XL177A: 10 μM, Spautin-1: 10 μM, IU1: 10 μM, AZ1: 10 μM, MF-094: 10 μM, LDN-57444: 10 μM, TCID: 10 μM, PR-619: 10 μM, BAY11-7082: 10 μM, EOAI3402143: 2.5 μM, ML364: 10 μM, b-AP15: 0.5 μM. ( B ) HEK293T cells were transfected with GST-GPX4 and Flag-USP. The cell lysate was applied with GST pull-down, then analyzed with immunoblot for indicated proteins. ( C ) 769-P and A549 cells were subjected to immunoprecipitate with anti-GPX4 antibodies, then analyzed with immunoblot for indicated proteins. ( D ) Overview of USP20 structures. ( E-F ) HEK293T cells transfected with the indicated USP20 structures and Flag-GPX4 were subjected to pull-down with GSH beads or immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( G ) 769-P and A549 cells were subjected to subcellular fractionation, then analyzed with immunoblot for indicated proteins. ( H ) Overview of GPX4 isoforms structures. ( I ) HEK293T cells transfected with the indicated GPX4 isoforms and GST-USP20 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( J ) HEK293T cells transfected with the GST-USP20 WT/C154S and Flag-GPX4 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins.

Journal: Redox Biology

Article Title: USP20 governs tyrosine kinase inhibitors resistance through ferroptosis evasion by targeting GPX4 in cancers

doi: 10.1016/j.redox.2026.104086

Figure Lengend Snippet: USP20 directly interacts with GPX4. ( A ) Immunoblot analysis of target proteins in sorafenib-resistant 769-P and A549 cells following 24 h treatment with specific deubiquitinase inhibitors. ML-323: 10 μM, GSK2643943A: 10 μM, XL177A: 10 μM, Spautin-1: 10 μM, IU1: 10 μM, AZ1: 10 μM, MF-094: 10 μM, LDN-57444: 10 μM, TCID: 10 μM, PR-619: 10 μM, BAY11-7082: 10 μM, EOAI3402143: 2.5 μM, ML364: 10 μM, b-AP15: 0.5 μM. ( B ) HEK293T cells were transfected with GST-GPX4 and Flag-USP. The cell lysate was applied with GST pull-down, then analyzed with immunoblot for indicated proteins. ( C ) 769-P and A549 cells were subjected to immunoprecipitate with anti-GPX4 antibodies, then analyzed with immunoblot for indicated proteins. ( D ) Overview of USP20 structures. ( E-F ) HEK293T cells transfected with the indicated USP20 structures and Flag-GPX4 were subjected to pull-down with GSH beads or immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( G ) 769-P and A549 cells were subjected to subcellular fractionation, then analyzed with immunoblot for indicated proteins. ( H ) Overview of GPX4 isoforms structures. ( I ) HEK293T cells transfected with the indicated GPX4 isoforms and GST-USP20 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins. ( J ) HEK293T cells transfected with the GST-USP20 WT/C154S and Flag-GPX4 were subjected to immunoprecipitate with anti-Flag antibody, then analyzed with immunoblot for indicated proteins.

Article Snippet: Primary antibodies against USP20 (cat. no. 17491-1-AP; in ), HA-Tag (cat. no. 51064-2-AP), FLAG-Tag (cat. no. 20543-1-AP), GST-Tag (cat. no. 66001-2-Ig), β-Actin (cat. no. 66009-1-Ig), His-Tag (cat. no. 66005-1-Ig), GPX4(cat.no.67763-1-Ig), ACSL4 (cat. no. 22401-1-AP), SLC7A11 (cat. no. 26864-1-AP), FSP1 (cat. no. 20886-1-AP), FTH (cat. no. 11682-1-AP), Vinculin (cat. no. 26520-1-AP), MEK (cat. no. 11049-1-AP), TOMM20 (cat. no. 11802-1-AP), and H3 (cat. no. 17168-1-AP) were purchased from ProteinTech.

Techniques: Western Blot, Transfection, Fractionation

USP20 removes GPX4 K48-linked poly-ubiquitination. ( A ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, GST-USP20 and His-Ub. ( B ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, GST-USP20 WT/C154S and His-Ub. ( C ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, and His-Ub under the condition of the indicated concentration of GSK2643943A. ( D ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in USP20 knockdown HEK293T cells transfected with Flag-GPX4 and His-Ub. ( E ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, HA-USP20 and His-Ub WT or His-Ub K48−only . ( F ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, HA-USP20 and His-Ub WT or His-Ub K48R .

Journal: Redox Biology

Article Title: USP20 governs tyrosine kinase inhibitors resistance through ferroptosis evasion by targeting GPX4 in cancers

doi: 10.1016/j.redox.2026.104086

Figure Lengend Snippet: USP20 removes GPX4 K48-linked poly-ubiquitination. ( A ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, GST-USP20 and His-Ub. ( B ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, GST-USP20 WT/C154S and His-Ub. ( C ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, and His-Ub under the condition of the indicated concentration of GSK2643943A. ( D ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in USP20 knockdown HEK293T cells transfected with Flag-GPX4 and His-Ub. ( E ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, HA-USP20 and His-Ub WT or His-Ub K48−only . ( F ) Ubiquitination assay was used to analyze the ubiquitination of GPX4 in HEK293T cells transfected with Flag-GPX4, HA-USP20 and His-Ub WT or His-Ub K48R .

Article Snippet: Primary antibodies against USP20 (cat. no. 17491-1-AP; in ), HA-Tag (cat. no. 51064-2-AP), FLAG-Tag (cat. no. 20543-1-AP), GST-Tag (cat. no. 66001-2-Ig), β-Actin (cat. no. 66009-1-Ig), His-Tag (cat. no. 66005-1-Ig), GPX4(cat.no.67763-1-Ig), ACSL4 (cat. no. 22401-1-AP), SLC7A11 (cat. no. 26864-1-AP), FSP1 (cat. no. 20886-1-AP), FTH (cat. no. 11682-1-AP), Vinculin (cat. no. 26520-1-AP), MEK (cat. no. 11049-1-AP), TOMM20 (cat. no. 11802-1-AP), and H3 (cat. no. 17168-1-AP) were purchased from ProteinTech.

Techniques: Ubiquitin Proteomics, Transfection, Concentration Assay, Knockdown

Metabolic regulation of nucleus pulposus vells by SIN and DAB through MAPK and NF-κB pathways. (A) Volcano plot analysis of DE genes (TNF-α vs. TNF-α+SIN). (B) KEGG enrichment analysis of DE genes (TNF-α vs. TNF-α+SIN). (C) GSEA indicated MAPK signalling pathway enrichment. (D) Heatmap of ten selected differentially expressed genes (TNF-α vs. TNF-α+SIN). (E) Western blot analysis of key proteins in the MAPK signalling pathway (p-ERK, p-JNK, p-p38, ERK, JNK, and p38) in the different treatment groups. (F) Quantitative analysis of the Western blot data for MAPK signalling pathway proteins. (G–H) Western blot and quantitative analysis of p-ERK, p-JNK, p-p38, ERK, JNK, and p38 treated with or without TNF-α in the absence or presence of SIN (10 μM) (PCDNA 3.1 vs. TNFR1-OE).(I–L) Integrated analysis of TNF-α vs. TNF-α+DAB DEGs: Volcano plot of DE genes (significance/fold change), KEGG pathway enrichment of DE genes, NF-κB signalling enrichment in GSEA, and heatmap of ten selected differentially expressed genes. (M) Western blot analysis of key proteins in the NF-κB signalling pathway (p-IκBα, p-p65, IκBα, and p65) in the different treatment groups. (N) Quantitative analysis of the Western blot data for the NF-κB signalling pathway proteins. (O–P) Western blot and quantitative analysis of p-p65 and p65 (PCDNA 3.1 vs. TNFR1-OE). (Q) Matched diagram of b and y ions. (R) Western blot analysis of RELA in the different treatment groups. (S) Western blot analysis confirmed the stabilization of p65 by DAB. (T) The affinity between DAB and the p65 target protein was estimated after incubation at different temperatures via Western blot analysis. (n = 3; ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001).

Journal: Materials Today Bio

Article Title: Sequential delivery of sinigrin and dabigatran by an in situ self-stabilizing dynamic hydrogel attenuates intervertebral disc degeneration

doi: 10.1016/j.mtbio.2026.102827

Figure Lengend Snippet: Metabolic regulation of nucleus pulposus vells by SIN and DAB through MAPK and NF-κB pathways. (A) Volcano plot analysis of DE genes (TNF-α vs. TNF-α+SIN). (B) KEGG enrichment analysis of DE genes (TNF-α vs. TNF-α+SIN). (C) GSEA indicated MAPK signalling pathway enrichment. (D) Heatmap of ten selected differentially expressed genes (TNF-α vs. TNF-α+SIN). (E) Western blot analysis of key proteins in the MAPK signalling pathway (p-ERK, p-JNK, p-p38, ERK, JNK, and p38) in the different treatment groups. (F) Quantitative analysis of the Western blot data for MAPK signalling pathway proteins. (G–H) Western blot and quantitative analysis of p-ERK, p-JNK, p-p38, ERK, JNK, and p38 treated with or without TNF-α in the absence or presence of SIN (10 μM) (PCDNA 3.1 vs. TNFR1-OE).(I–L) Integrated analysis of TNF-α vs. TNF-α+DAB DEGs: Volcano plot of DE genes (significance/fold change), KEGG pathway enrichment of DE genes, NF-κB signalling enrichment in GSEA, and heatmap of ten selected differentially expressed genes. (M) Western blot analysis of key proteins in the NF-κB signalling pathway (p-IκBα, p-p65, IκBα, and p65) in the different treatment groups. (N) Quantitative analysis of the Western blot data for the NF-κB signalling pathway proteins. (O–P) Western blot and quantitative analysis of p-p65 and p65 (PCDNA 3.1 vs. TNFR1-OE). (Q) Matched diagram of b and y ions. (R) Western blot analysis of RELA in the different treatment groups. (S) Western blot analysis confirmed the stabilization of p65 by DAB. (T) The affinity between DAB and the p65 target protein was estimated after incubation at different temperatures via Western blot analysis. (n = 3; ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001).

Article Snippet: The membranes were then incubated overnight with anti-GAPDH (1:50 000, AC054, abclone, China), anti-Col2α1(1:500, A19308, abclone, China), anti-Acan (1:1000, A8536, abclone, China), anti-SOX9 (1:1000, A19710, abclone, China), anti-MMP13 (1:1000, A1606, abclone, China), anti-ADAMTS4 (1:500, A2525, abclone, China), anti-iNOS (1:1000, 18985-1-AP, proteintech, China), anti-COX2 (1:1000, 12375-1-AP, proteintech, China), anti-ERK (1:2000, 11257-1-AP, proteintech, China), anti-Phospho-ERK (1:1000, 28733-1-AP, proteintech, China), anti-JNK (1:500, 51153-1-AP, proteintech, China), anti-Phospho-JNK (1:1000, 80024-1-RR, proteintech, China), anti-p38 (1:1000, A4771, abclone, China), anti-Phospho-p38 (1:500, AP1508, abclone, China), anti-p65 (1:5000, A19653, abclone, China), anti-Phospho-p65 (1:500, AP0475, abclone, China), anti-IκBα (1:500, A1187, abclone, China), anti-Phospho-IκBα (1:500, AP0420, abclone, China), anti-AMPK (1:5000, A28094, abclone, China), anti-Phospho-AMPK (1:500, AP0432, abclone, China), The membrane was incubated with HRP-conjugated Goat anti-rabbit IgG (H + L) (1:50 000, AS014, rabbit monoclonal, Abclone, China) and immunoreactive proteins were detected using enhanced chemiluminescence.

Techniques: Western Blot, Incubation

PIM1 directly interacts with DDX41 and regulates its phosphorylation. ( A ) HCECs transfected with either pcDNA3.1 (Flag) or pcDNA3.1 PIM1 (Flag-PIM1) were stimulated with A. fumigatus hyphae (1 × 10 6 hyphal fragments/mL) for 12 hours. Cell lysates were immunoprecipitated using anti-Flag beads, and bound proteins were separated by SDS-PAGE and visualized by silver staining. ( B ) A GST pull-down assay was performed to examine direct binding between PIM1 and DDX41. ( C ) Endogenous interaction between PIM1 and DDX41 in HCECs was assessed by co-IP. HEK293T cells were cotransfected with Flag-PIM1 and Myc-DDX41 for 48 hours. (D) Co-IP was carried out with anti-Flag beads, and Myc-DDX41 was detected with anti-Myc antibody. ( E ) Reciprocal co-IP was performed using anti-Myc beads, and Flag-PIM1 was probed with anti-Flag antibody. ( F ) HCECs were transfected with NC siRNA (siNC) or PIM1 siRNAs (siPIM1-1 and siPIM1-2) for 24 hours, then exposed to A. fumigatus hyphae for 12 hours. DDX41 was immunoprecipitated and immunoblotted with anti–p-Ser and DDX41 antibodies. ( G ) HCECs were transfected with pcDNA3.1 (Vector) or pcDNA3.1-PIM1 (PIM1) for 24 hours, then exposed to A. fumigatus hyphae for 12 hours, followed by DDX41 immunoprecipitation and immunoblotting with indicated antibodies. ( H ) HCECs were transfected with NC siRNA (siNC), PIM1 siRNA (siPIM1-2), and/or pcDNA3.1-PIM1 (PIM1) for 24 hours, then treated with A. fumigatus hyphae for 12 hours. Co-IP of DDX41 was performed, and associated proteins were analyzed by Western blot. ( I ) Quantification of protein levels in ( H ). ( J ) HCECs were pretreated with SGI-1776 (0 and 4 µM) for 12 hours prior to 12-hour stimulation with A. fumigatus hyphae. Co-IP assay was performed using anti-DDX41 antibody and immunoblotted with the antibodies indicated. ( K ) Quantification of protein levels in ( J ). ( L ) Recombinant His-PIM1 and GST-DDX41 were incubated in reaction buffer with or without phosphatase for 30 minutes. The protein levels of p-Ser, His-PIM1, and GST-DDX41 were detected by Western blot. Quantification of protein levels in F, G, and L is shown in A–C. Data are presented as the mean ± SD; ** P < 0.01; n = 3.

Journal: Investigative Ophthalmology & Visual Science

Article Title: PIM1 Inhibition Alleviates Aspergillus fumigatus Keratitis by Regulating DDX41-Mediated STING Signaling Pathway

doi: 10.1167/iovs.67.4.2

Figure Lengend Snippet: PIM1 directly interacts with DDX41 and regulates its phosphorylation. ( A ) HCECs transfected with either pcDNA3.1 (Flag) or pcDNA3.1 PIM1 (Flag-PIM1) were stimulated with A. fumigatus hyphae (1 × 10 6 hyphal fragments/mL) for 12 hours. Cell lysates were immunoprecipitated using anti-Flag beads, and bound proteins were separated by SDS-PAGE and visualized by silver staining. ( B ) A GST pull-down assay was performed to examine direct binding between PIM1 and DDX41. ( C ) Endogenous interaction between PIM1 and DDX41 in HCECs was assessed by co-IP. HEK293T cells were cotransfected with Flag-PIM1 and Myc-DDX41 for 48 hours. (D) Co-IP was carried out with anti-Flag beads, and Myc-DDX41 was detected with anti-Myc antibody. ( E ) Reciprocal co-IP was performed using anti-Myc beads, and Flag-PIM1 was probed with anti-Flag antibody. ( F ) HCECs were transfected with NC siRNA (siNC) or PIM1 siRNAs (siPIM1-1 and siPIM1-2) for 24 hours, then exposed to A. fumigatus hyphae for 12 hours. DDX41 was immunoprecipitated and immunoblotted with anti–p-Ser and DDX41 antibodies. ( G ) HCECs were transfected with pcDNA3.1 (Vector) or pcDNA3.1-PIM1 (PIM1) for 24 hours, then exposed to A. fumigatus hyphae for 12 hours, followed by DDX41 immunoprecipitation and immunoblotting with indicated antibodies. ( H ) HCECs were transfected with NC siRNA (siNC), PIM1 siRNA (siPIM1-2), and/or pcDNA3.1-PIM1 (PIM1) for 24 hours, then treated with A. fumigatus hyphae for 12 hours. Co-IP of DDX41 was performed, and associated proteins were analyzed by Western blot. ( I ) Quantification of protein levels in ( H ). ( J ) HCECs were pretreated with SGI-1776 (0 and 4 µM) for 12 hours prior to 12-hour stimulation with A. fumigatus hyphae. Co-IP assay was performed using anti-DDX41 antibody and immunoblotted with the antibodies indicated. ( K ) Quantification of protein levels in ( J ). ( L ) Recombinant His-PIM1 and GST-DDX41 were incubated in reaction buffer with or without phosphatase for 30 minutes. The protein levels of p-Ser, His-PIM1, and GST-DDX41 were detected by Western blot. Quantification of protein levels in F, G, and L is shown in A–C. Data are presented as the mean ± SD; ** P < 0.01; n = 3.

Article Snippet: Antibodies targeting PIM2 (25865-1-AP, 1:1000), PIM3 (33202-1-AP, 1:1000), β-actin (20536-1-AP, 1:50,000), GST (10000-0-AP, 1:2000), MYC (16286-1-AP, 1:2000), Flag (66008-4-Ig, 1:2000), His (66005-1-Ig, 1:2000), STING (19851-1-AP, 1:2000), IRF3 (11312-1-AP, 1:1000), and TBK1 (28397-1-AP, 1:1000) were sourced from Proteintech (Wuhan, China).

Techniques: Phospho-proteomics, Transfection, Immunoprecipitation, SDS Page, Silver Staining, Pull Down Assay, Binding Assay, Co-Immunoprecipitation Assay, Plasmid Preparation, Western Blot, Recombinant, Incubation

The anti-tumor immune mechanism of ICCP NPs. a) Schematic illustration of cuproptosis mechanism. b) Immunofluorescence analysis of DLAT and FDX1 in 4T1 cells following various treatments. c) Schematic diagram illustrating the synergistic induction of ICD by SDT and cuproptosis. d) Immunofluorescence analysis of CRT and HMGB1 in 4T1 cells following various treatments. e) Quantitative analysis of CRT fluorescence intensity. f) ATP content in 4T1 cells following various treatments.

Journal: Materials Today Bio

Article Title: A precise theranostic nanoplatform amplifies anti-tumor efficacy via copper ionophores and sonodynamic therapy

doi: 10.1016/j.mtbio.2026.102957

Figure Lengend Snippet: The anti-tumor immune mechanism of ICCP NPs. a) Schematic illustration of cuproptosis mechanism. b) Immunofluorescence analysis of DLAT and FDX1 in 4T1 cells following various treatments. c) Schematic diagram illustrating the synergistic induction of ICD by SDT and cuproptosis. d) Immunofluorescence analysis of CRT and HMGB1 in 4T1 cells following various treatments. e) Quantitative analysis of CRT fluorescence intensity. f) ATP content in 4T1 cells following various treatments.

Article Snippet: Cells were then incubated overnight at 4 °C with primary rabbit polyclonal antibodies against DLAT (13426-1-AP, 1:200), FDX1 (12592-1-AP, 1:250), CRT (10292-1-AP, 1:200), and HMGB1 (10829-1-AP, 1:200) (Proteintech, Wuhan, China).

Techniques: Immunofluorescence, Fluorescence

ICCP NPs mediated anti-tumor immunity in vivo . a) Schematic diagram llustrating the synergistic anti-tumor immune mechanism of ICCP NPs through SDT and cuproptosis. b) Immunofluorescence analysis of CRT and HMGB1 across different treatments. c) Assessment of mature DC proportions (CD80 + /CD86 + ) in tumor tissues via flow cytometry and d) corresponding quantitative analysis. e) Assessment of CD4 + T cells proportions in tumor tissues via flow cytometry and f) corresponding quantitative analysis. g) Assessment of CD8 + T cells proportions in tumor tissues via flow cytometry and h) corresponding quantitative analysis.

Journal: Materials Today Bio

Article Title: A precise theranostic nanoplatform amplifies anti-tumor efficacy via copper ionophores and sonodynamic therapy

doi: 10.1016/j.mtbio.2026.102957

Figure Lengend Snippet: ICCP NPs mediated anti-tumor immunity in vivo . a) Schematic diagram llustrating the synergistic anti-tumor immune mechanism of ICCP NPs through SDT and cuproptosis. b) Immunofluorescence analysis of CRT and HMGB1 across different treatments. c) Assessment of mature DC proportions (CD80 + /CD86 + ) in tumor tissues via flow cytometry and d) corresponding quantitative analysis. e) Assessment of CD4 + T cells proportions in tumor tissues via flow cytometry and f) corresponding quantitative analysis. g) Assessment of CD8 + T cells proportions in tumor tissues via flow cytometry and h) corresponding quantitative analysis.

Article Snippet: Cells were then incubated overnight at 4 °C with primary rabbit polyclonal antibodies against DLAT (13426-1-AP, 1:200), FDX1 (12592-1-AP, 1:250), CRT (10292-1-AP, 1:200), and HMGB1 (10829-1-AP, 1:200) (Proteintech, Wuhan, China).

Techniques: In Vivo, Immunofluorescence, Flow Cytometry